Genomic sequences of pri-miRNAs were obtained from UCSC Genome Browser. Each pri-miRNA analyzed consists of the pre-miRNA and flanking sequences of 30 nt both sides. The secondary structure was obtained using RNAfold (Gruber et al., 2008), and the bracket-dot notation of the lower stem was analyzed using this R scripts.
In summary, we first tested whether a nucleotide in one position is paired with another on the other side of the pre-miRNA. Nucleotides that failed such a test were labeled as unpaired. Then, we aligned all pri-miRNA 5p sequences by the 5’ Drosha cleavage site (5’ end of pre-miRNA) and aligned all 3p sequences by the 3’ Drosha cleavage site (3’ end of pre-miRNA). The fraction of paired nucleotides was calculated for each position and was plotted against its relative distance to the Drosha cleavage site.
Secondary structure from pri-miRNA sequence reported in miRBase 21 usually don't contain many upstream or downstream nucleotides from the Drosha cleavage sites.
>hsa-mir-9-1 MI0000466
CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCA
.(((((((....((((.(((((((((((((((.((((((.(.(....).).)))))).))))))))))))))).))))...))))))).
Therefore, we obtained the secondary structure from pri-miRNA sequence obtained using RNAfold on longer genomic sequences on UCSC Genome Browser.
......(((((...(.(((((((....((((.(((((((((((((((.((((((.(.(....).).)))))).))))))))))))))).))))...))))))).)...))).)).......
Note that in most cases the secondary structure of the pri-miRNA sequence reported in miRBase21 is already included in the longer sequence. Most discrepancies might come from alternative foldings derived from providing extra-context to RNAfold.
Structure of the 5' lower stem
-30__________________________-1
......(((((...(.(((((((....(((
Structure of the 3' lower stem
+1_________________________+30
))...))))))).)...))).)).......
For each position on the lower stem, we count the frequency of nucleotides on the 5' with (
over the total, while on the 3' we count only the )
.
It is not unfrequent to detect pri-miRNA where the lower stem, due to its less structured nature, presents secondary stems.
hsa-mir-152 5' lower stem
-30__________________________-1
..((((...)))..))((((..((.(((((
In such cases, our script excludes those positions from the being counted as "lower stem base-paired" nucleotides. To that aim our code replaces in the bracket-dot notation, the brackets on the secondary stem for *
.
hsa-mir-152 5' lower stem
-30__________________________-1
..***....***..**((((..((.(((((
This code was written by Susanna Chen and supervised by Xavier Bofill-De Ros.