From 3871d436d6bee8170be5cd319c4833b61bc4a757 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Tue, 21 Mar 2023 18:46:41 +0100 Subject: [PATCH 001/111] fixed typo in docs --- nextflow_schema.json | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/nextflow_schema.json b/nextflow_schema.json index 49949544..4dc5a6e4 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -22,7 +22,7 @@ "mode": { "type": "string", "default": "fastq", - "description": "Specify the processing mode for the pipeline. Available options are \"fastq\" and \"assembled\".ptions are: 'raw'", + "description": "Specify the processing mode for the pipeline. Available options are \"fastq\" and \"assembled\".", "enum": ["fastq", "assembled"], "fa_icon": "fas fa-terminal" }, From 323bb6fb88d7da5b1465b049857c6ddbf46adf96 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Wed, 19 Apr 2023 18:03:41 +0200 Subject: [PATCH 002/111] dont write filter pass output repertoire if empty --- bin/reveal_filter_quality.R | 6 +++++- 1 file changed, 5 insertions(+), 1 deletion(-) diff --git a/bin/reveal_filter_quality.R b/bin/reveal_filter_quality.R index fb97afb8..5ed0258c 100755 --- a/bin/reveal_filter_quality.R +++ b/bin/reveal_filter_quality.R @@ -89,12 +89,16 @@ if (!is.null(opt$OUTPUT)) { } else { output_fn <- sub(".tsv$", "_quality-pass.tsv", basename(opt$REPERTOIRE)) } -write_rearrangement(db[filter_pass, ], file = output_fn) +# don't write if empty +if (sum(filter_pass)>0) { + write_rearrangement(db[filter_pass, ], file = output_fn) +} # cat(" TOTAL_GROUPS> ", n_groups, "\n", sep=" ", file = file.path(out_dir, log_verbose_name), append=TRUE) write("START> FilterQuality", stdout()) write(paste0("FILE> ", basename(opt$REPERTOIRE)), stdout()) +# even if output file not written, because empty, keep track in log write(paste0("OUTPUT> ", basename(output_fn)), stdout()) write(paste0("PASS> ", sum(filter_pass)), stdout()) write(paste0("FAIL> ", sum(!filter_pass) + sum(filter_na)), stdout()) From 55f002ffc490d51b6c857bff5a674863feba4e55 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Wed, 19 Apr 2023 18:17:45 +0200 Subject: [PATCH 003/111] forgot to make this output optional --- modules/local/reveal/filter_quality.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/modules/local/reveal/filter_quality.nf b/modules/local/reveal/filter_quality.nf index 3b33b92c..564a51f0 100644 --- a/modules/local/reveal/filter_quality.nf +++ b/modules/local/reveal/filter_quality.nf @@ -12,7 +12,7 @@ process FILTER_QUALITY { tuple val(meta), path(tab) // sequence tsv in AIRR format output: - tuple val(meta), path("*quality-pass.tsv"), emit: tab // sequence tsv in AIRR format + tuple val(meta), path("*quality-pass.tsv"), optional:true, emit: tab // sequence tsv in AIRR format path("*_command_log.txt"), emit: logs //process logs path "versions.yml", emit: versions From 57a6ec4b9cac75c5333f87cf177cdddba396fce0 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Thu, 20 Apr 2023 18:35:09 +0200 Subject: [PATCH 004/111] added dowser ext.args minseq, traits and tips --- conf/modules.config | 5 ++++- 1 file changed, 4 insertions(+), 1 deletion(-) diff --git a/conf/modules.config b/conf/modules.config index adf238b0..44238d01 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -447,7 +447,10 @@ process { mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] - ext.args = ['build':'igphyml'] + ext.args = ['build':'igphyml', + 'minseq':5, + 'traits':'c_call', + 'tips':'c_call'] } // withName: CHANGEO_PARSEDB_SELECT { From 67ffd271f17a772a3ed7155e62f4248b24a5639b Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Wed, 17 May 2023 11:14:10 +0200 Subject: [PATCH 005/111] updated error message --- subworkflows/local/clonal_analysis.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/subworkflows/local/clonal_analysis.nf b/subworkflows/local/clonal_analysis.nf index ddf31550..3ec4945e 100644 --- a/subworkflows/local/clonal_analysis.nf +++ b/subworkflows/local/clonal_analysis.nf @@ -35,7 +35,7 @@ workflow CLONAL_ANALYSIS { .dump(tag: 'clone_threshold') .filter { it != 'NA'} .filter { it != 'NaN' } - .ifEmpty { error "Automatic clone_threshold is 'NA'. Consider setting params.threshold manually."} + .ifEmpty { error "Automatic clone_threshold is 'NA'. Consider setting --clonal_threshold manually."} } else { clone_threshold = params.clonal_threshold From a1e467496a9262ed31063a56c9465111ef348ad5 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Sat, 27 May 2023 10:28:28 +0200 Subject: [PATCH 006/111] rm to have igblast reassign the c_call --- conf/modules.config | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/conf/modules.config b/conf/modules.config index 44238d01..b58928fb 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -286,7 +286,7 @@ process { mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] - ext.args = '--if sequence_id --sf sequence --mf cell_id consensus_count duplicate_count c_call c_cigar c_sequence_start c_sequence_end' + ext.args = '--if sequence_id --sf sequence --mf cell_id consensus_count duplicate_count' } From 480842253980d30495b685da4778d6ffed93fd94 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Thu, 8 Jun 2023 21:31:04 +0200 Subject: [PATCH 007/111] fix error directory or other parameter too long --- modules/local/enchantr/report_file_size.nf | 4 ++-- subworkflows/local/repertoire_analysis_reporting.nf | 8 +++++++- 2 files changed, 9 insertions(+), 3 deletions(-) diff --git a/modules/local/enchantr/report_file_size.nf b/modules/local/enchantr/report_file_size.nf index b4f9130d..ca6f6825 100644 --- a/modules/local/enchantr/report_file_size.nf +++ b/modules/local/enchantr/report_file_size.nf @@ -14,6 +14,7 @@ process REPORT_FILE_SIZE { input: path logs path metadata + path logs_tabs output: path "*_report", emit: file_size @@ -22,9 +23,8 @@ process REPORT_FILE_SIZE { script: """ - echo "${logs.join('\n')}" > logs.txt Rscript -e "enchantr::enchantr_report('file_size', \\ - report_params=list('input'='logs.txt', 'metadata'='${metadata}',\\ + report_params=list('input'='${logs_tabs}', 'metadata'='${metadata}',\\ 'outdir'=getwd()))" echo "\"${task.process}\":" > versions.yml diff --git a/subworkflows/local/repertoire_analysis_reporting.nf b/subworkflows/local/repertoire_analysis_reporting.nf index bab6b21d..1bd61a08 100644 --- a/subworkflows/local/repertoire_analysis_reporting.nf +++ b/subworkflows/local/repertoire_analysis_reporting.nf @@ -55,10 +55,16 @@ workflow REPERTOIRE_ANALYSIS_REPORTING { ch_reassign_logs, ch_sc_qc_and_filter_logs, ch_clonal_analysis_logs) + ch_logs_tabs = ch_logs.collect() + .flatten() + .map{ it -> it.getName().toString() } + .dump(tag: 'ch_logs_tabs') + .collectFile(name: 'all_logs_tabs.txt', newLine: true) REPORT_FILE_SIZE( ch_logs.collect().ifEmpty([]), - ch_metadata + ch_metadata, + ch_logs_tabs ) ch_versions = ch_versions.mix(REPORT_FILE_SIZE.out.versions) From 92988fafb18fef322f75461566987e6cc5e17652 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Thu, 8 Jun 2023 22:57:28 +0200 Subject: [PATCH 008/111] revert --- modules/local/enchantr/report_file_size.nf | 4 ++-- subworkflows/local/repertoire_analysis_reporting.nf | 8 +------- 2 files changed, 3 insertions(+), 9 deletions(-) diff --git a/modules/local/enchantr/report_file_size.nf b/modules/local/enchantr/report_file_size.nf index ca6f6825..b4f9130d 100644 --- a/modules/local/enchantr/report_file_size.nf +++ b/modules/local/enchantr/report_file_size.nf @@ -14,7 +14,6 @@ process REPORT_FILE_SIZE { input: path logs path metadata - path logs_tabs output: path "*_report", emit: file_size @@ -23,8 +22,9 @@ process REPORT_FILE_SIZE { script: """ + echo "${logs.join('\n')}" > logs.txt Rscript -e "enchantr::enchantr_report('file_size', \\ - report_params=list('input'='${logs_tabs}', 'metadata'='${metadata}',\\ + report_params=list('input'='logs.txt', 'metadata'='${metadata}',\\ 'outdir'=getwd()))" echo "\"${task.process}\":" > versions.yml diff --git a/subworkflows/local/repertoire_analysis_reporting.nf b/subworkflows/local/repertoire_analysis_reporting.nf index 1bd61a08..bab6b21d 100644 --- a/subworkflows/local/repertoire_analysis_reporting.nf +++ b/subworkflows/local/repertoire_analysis_reporting.nf @@ -55,16 +55,10 @@ workflow REPERTOIRE_ANALYSIS_REPORTING { ch_reassign_logs, ch_sc_qc_and_filter_logs, ch_clonal_analysis_logs) - ch_logs_tabs = ch_logs.collect() - .flatten() - .map{ it -> it.getName().toString() } - .dump(tag: 'ch_logs_tabs') - .collectFile(name: 'all_logs_tabs.txt', newLine: true) REPORT_FILE_SIZE( ch_logs.collect().ifEmpty([]), - ch_metadata, - ch_logs_tabs + ch_metadata ) ch_versions = ch_versions.mix(REPORT_FILE_SIZE.out.versions) From 2cd8a5315f2f2850376cfc01bcea4c8009bd2527 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Thu, 15 Jun 2023 15:20:57 +0200 Subject: [PATCH 009/111] =?UTF-8?q?(=EF=BC=A0=5F=EF=BC=A0)?= MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit --- modules/local/enchantr/report_file_size.nf | 4 ++-- subworkflows/local/repertoire_analysis_reporting.nf | 8 +++++++- 2 files changed, 9 insertions(+), 3 deletions(-) diff --git a/modules/local/enchantr/report_file_size.nf b/modules/local/enchantr/report_file_size.nf index b4f9130d..ca6f6825 100644 --- a/modules/local/enchantr/report_file_size.nf +++ b/modules/local/enchantr/report_file_size.nf @@ -14,6 +14,7 @@ process REPORT_FILE_SIZE { input: path logs path metadata + path logs_tabs output: path "*_report", emit: file_size @@ -22,9 +23,8 @@ process REPORT_FILE_SIZE { script: """ - echo "${logs.join('\n')}" > logs.txt Rscript -e "enchantr::enchantr_report('file_size', \\ - report_params=list('input'='logs.txt', 'metadata'='${metadata}',\\ + report_params=list('input'='${logs_tabs}', 'metadata'='${metadata}',\\ 'outdir'=getwd()))" echo "\"${task.process}\":" > versions.yml diff --git a/subworkflows/local/repertoire_analysis_reporting.nf b/subworkflows/local/repertoire_analysis_reporting.nf index bab6b21d..1bd61a08 100644 --- a/subworkflows/local/repertoire_analysis_reporting.nf +++ b/subworkflows/local/repertoire_analysis_reporting.nf @@ -55,10 +55,16 @@ workflow REPERTOIRE_ANALYSIS_REPORTING { ch_reassign_logs, ch_sc_qc_and_filter_logs, ch_clonal_analysis_logs) + ch_logs_tabs = ch_logs.collect() + .flatten() + .map{ it -> it.getName().toString() } + .dump(tag: 'ch_logs_tabs') + .collectFile(name: 'all_logs_tabs.txt', newLine: true) REPORT_FILE_SIZE( ch_logs.collect().ifEmpty([]), - ch_metadata + ch_metadata, + ch_logs_tabs ) ch_versions = ch_versions.mix(REPORT_FILE_SIZE.out.versions) From d669012a96e196687ec06d6d961070f891ae895e Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Thu, 15 Jun 2023 17:59:41 +0200 Subject: [PATCH 010/111] fixes for large .command.sh --- modules/local/enchantr/find_threshold.nf | 3 ++- subworkflows/local/clonal_analysis.nf | 16 ++++++++++++++-- 2 files changed, 16 insertions(+), 3 deletions(-) diff --git a/modules/local/enchantr/find_threshold.nf b/modules/local/enchantr/find_threshold.nf index c4fc1697..643958db 100644 --- a/modules/local/enchantr/find_threshold.nf +++ b/modules/local/enchantr/find_threshold.nf @@ -30,6 +30,7 @@ process FIND_THRESHOLD { input: path tab // sequence tsv in AIRR format path logo + path tabs_samplesheet output: // tuple val(meta), path("*threshold-pass.tsv"), emit: tab // sequence tsv in AIRR format @@ -43,7 +44,7 @@ process FIND_THRESHOLD { def args = task.ext.args ? asString(task.ext.args) : '' """ Rscript -e "enchantr::enchantr_report('find_threshold', \\ - report_params=list('input'='${tab.join(',')}',\\ + report_params=list('input'='${tabs_samplesheet}',\\ 'cloneby'='${params.cloneby}',\\ 'crossby'='${params.crossby}',\\ 'singlecell'='${params.singlecell}',\\ diff --git a/subworkflows/local/clonal_analysis.nf b/subworkflows/local/clonal_analysis.nf index a6335717..78d46c2e 100644 --- a/subworkflows/local/clonal_analysis.nf +++ b/subworkflows/local/clonal_analysis.nf @@ -19,10 +19,16 @@ workflow CLONAL_ANALYSIS { ch_find_threshold = ch_repertoire.map{ it -> it[1] } .collect() + ch_find_threshold_samplesheet = ch_find_threshold + .flatten() + .map{ it -> it.getName().toString() } + .dump(tag: 'ch_find_threshold_samplesheet') + .collectFile(name: 'find_threshold_samplesheet.txt', newLine: true) FIND_CLONAL_THRESHOLD ( ch_find_threshold, - ch_logo + ch_logo, + ch_find_threshold_samplesheet ) ch_threshold = FIND_CLONAL_THRESHOLD.out.mean_threshold ch_versions = ch_versions.mix(FIND_CLONAL_THRESHOLD.out.versions) @@ -39,10 +45,16 @@ workflow CLONAL_ANALYSIS { ch_find_threshold = ch_repertoire.map{ it -> it[1] } .collect() + ch_find_threshold_samplesheet = ch_find_threshold + .flatten() + .map{ it -> it.getName().toString() } + .dump(tag: 'ch_find_threshold_samplesheet') + .collectFile(name: 'find_threshold_samplesheet.txt', newLine: true) REPORT_THRESHOLD ( ch_find_threshold, - ch_logo + ch_logo, + ch_find_threshold_samplesheet ) ch_versions = ch_versions.mix(REPORT_THRESHOLD.out.versions) From 48d8826237e80e5f9f938c5cbbe25b735e642787 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Fri, 16 Jun 2023 11:16:35 +0200 Subject: [PATCH 011/111] fixes for large .commad.sh --- modules/local/enchantr/define_clones.nf | 9 ++++++++- subworkflows/local/clonal_analysis.nf | 14 ++++++++++++-- 2 files changed, 20 insertions(+), 3 deletions(-) diff --git a/modules/local/enchantr/define_clones.nf b/modules/local/enchantr/define_clones.nf index c271f874..b8dc498c 100644 --- a/modules/local/enchantr/define_clones.nf +++ b/modules/local/enchantr/define_clones.nf @@ -30,6 +30,7 @@ process DEFINE_CLONES { tuple val(meta), path(tabs) // meta, sequence tsv in AIRR format val threshold path imgt_base + path repertoires_samplesheet output: path("*/*/*clone-pass.tsv"), emit: tab // sequence tsv in AIRR format @@ -41,9 +42,15 @@ process DEFINE_CLONES { script: def args = task.ext.args ? asString(task.ext.args) : '' def thr = threshold.join("") + def input = "" + if (repertoires_samplesheet) { + input = repertoires_samplesheet + } else { + input = tabs.join(',') + } """ Rscript -e "enchantr::enchantr_report('define_clones', \\ - report_params=list('input'='${tabs.join(',')}', \\ + report_params=list('input'='${input}', \\ 'imgt_db'='${imgt_base}', \\ 'cloneby'='${params.cloneby}', \\ 'force'=FALSE, \\ diff --git a/subworkflows/local/clonal_analysis.nf b/subworkflows/local/clonal_analysis.nf index 78d46c2e..ff4afacf 100644 --- a/subworkflows/local/clonal_analysis.nf +++ b/subworkflows/local/clonal_analysis.nf @@ -75,8 +75,10 @@ workflow CLONAL_ANALYSIS { DEFINE_CLONES_COMPUTE( ch_define_clones, clone_threshold.collect(), - ch_imgt.collect() + ch_imgt.collect(), + [] ) + ch_versions = ch_versions.mix(DEFINE_CLONES_COMPUTE.out.versions) ch_logs = ch_logs.mix(DEFINE_CLONES_COMPUTE.out.logs) @@ -88,10 +90,18 @@ workflow CLONAL_ANALYSIS { if (!params.skip_all_clones_report){ + ch_all_repertoires_cloned_samplesheet = ch_all_repertoires_cloned.map{ it -> it[1] } + .collect() + .flatten() + .map{ it -> it.getName().toString() } + .dump(tag: 'ch_all_repertoires_cloned_samplesheet') + .collectFile(name: 'all_repertoires_cloned_samplesheet.txt', newLine: true) + DEFINE_CLONES_REPORT( ch_all_repertoires_cloned, clone_threshold.collect(), - ch_imgt.collect() + ch_imgt.collect(), + ch_all_repertoires_cloned_samplesheet ) } From a64488287fd562d4edb621de4ca16ec4fb07d3c1 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Sat, 17 Jun 2023 21:00:24 +0200 Subject: [PATCH 012/111] user airr, stringi and subset data --- assets/repertoire_comparison.Rmd | 31 +++++++++++++++++++++++-------- 1 file changed, 23 insertions(+), 8 deletions(-) diff --git a/assets/repertoire_comparison.Rmd b/assets/repertoire_comparison.Rmd index 16de9bd6..54cb996f 100644 --- a/assets/repertoire_comparison.Rmd +++ b/assets/repertoire_comparison.Rmd @@ -29,8 +29,9 @@ library(dplyr) library(tidyr) library(alakazam) library(shazam) -library(stringr) +library(stringi) library(plotly) +library(airr) theme_set(theme_bw(base_family = "ArialMT") + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), text = element_text(family="ArialMT"))) @@ -152,14 +153,28 @@ dir.create(abundance_dir) dir.create(vfamily_dir) # Generate one big dataframe from all patient dataframes - -df_list = lapply(all_files, read.csv, sep="\t") - -df_all <- dplyr::bind_rows(df_list) +col_select <- c( + "sample_id", "subject_id", "sequence_id", "clone_id", + "v_call", "d_call", "j_call", + "locus", + "junction", + "pcr_target_locus" +) +i <- 0 +df_all <- dplyr::bind_rows(lapply(all_files, + function(x) { + i <<- i +1 + message("Loading file #",i,":",x) + read_rearrangement(x, col_select=col_select) + }) +) # Remove underscores in these columns -df_all$subject_id <- sapply(df_all$subject_id, function(x) str_replace(as.character(x), "_", "")) -df_all$sample_id <- sapply(df_all$sample_id, function(x) str_replace(as.character(x), "_", "")) +# df_all$subject_id <- sapply(df_all$subject_id, function(x) str_replace(as.character(x), "_", "")) +df_all$subject_id <- stringi::stri_replace_first_fixed(df_all$subject_id, "_", "") + +# df_all$sample_id <- sapply(df_all$sample_id, function(x) str_replace(as.character(x), "_", "")) +df_all$sample_id <- stringi::stri_replace_first_fixed(df_all$sample_id, "_", "") # Annotate sample and samplepop (sample + population) by add ing all the conditions df_all$subj_locus <- as.factor(paste(df_all$sample_id, df_all$subject_id, df_all$pcr_target_locus, sep="_")) @@ -168,7 +183,7 @@ df_all$subj_locus <- as.factor(paste(df_all$sample_id, df_all$subject_id, df_all write.table(df_all, paste0(outdir,"/all_data.tsv"), sep = "\t", quote=F, row.names = F, col.names = T) # Set number of bootrstraps -nboot = 200 +nboot <- 200 ``` # Clonal abundance From be281bdcffa87c9e3c00e80e86d230e6820f4004 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Tue, 20 Jun 2023 13:42:14 -0400 Subject: [PATCH 013/111] fix report use read rearrangement --- assets/repertoire_comparison.Rmd | 58 +++++++++++++++++--------------- 1 file changed, 31 insertions(+), 27 deletions(-) diff --git a/assets/repertoire_comparison.Rmd b/assets/repertoire_comparison.Rmd index 16de9bd6..6f6f758d 100644 --- a/assets/repertoire_comparison.Rmd +++ b/assets/repertoire_comparison.Rmd @@ -31,6 +31,7 @@ library(alakazam) library(shazam) library(stringr) library(plotly) +library(airr) theme_set(theme_bw(base_family = "ArialMT") + theme(panel.grid.major = element_blank(), panel.grid.minor = element_blank(), text = element_text(family="ArialMT"))) @@ -54,21 +55,10 @@ datadir <- "." Number of reads for each of the samples and number of sequences left after performing sequence assembly and alignment to reference data. The full table can be found under [Table_sequences_assembly](repertoire_comparison/Sequence_numbers_summary/Table_sequences_assembly.tsv). -```{r seq_numbers, echo=FALSE, warning=FALSE, results='asis'} -read_table <- function(tab_file){ - tab_seqs <- read.table(tab_file, header=TRUE, sep="\t", check.names = FALSE) - write.table(tab_seqs, file=paste0(seq_dir,"/Table_sequences_assembly.tsv"), sep="\t", quote=F, row.names=F) - } -tryCatch( {read_table("./Table_sequences.tsv")} , - error=function(e){message("No sequence numbers are available if starting with assembled reads.")} -) - -``` - - ```{r seq_numbers_plot, echo=FALSE, warning=FALSE, results='asis'} tryCatch( { tab_seqs <- read.table("./Table_sequences.tsv", header=TRUE, sep="\t", check.names = FALSE) + write.table(tab_seqs, file=paste0(seq_dir,"/Table_sequences_assembly.tsv"), sep="\t", quote=F, row.names=F) plot_table <- tidyr::pivot_longer(tab_seqs, cols=Sequences_R1:Igblast, @@ -88,6 +78,8 @@ tryCatch( { theme(axis.text.x= element_text(angle = 45)) ggplotly(seqs_plot) + + }, error=function(e){message("No sequence numbers are available if starting with assembled reads.")} ) @@ -144,33 +136,32 @@ ggplotly(seqs_plot_assembled) # in the current folder all_files <- system(paste0("find '", datadir, "' -name '*clone-pass.tsv'"), intern=T) -diversity_dir <- paste(outdir, "Diversity", sep="/") -abundance_dir <- paste(outdir, "Abundance", sep="/") vfamily_dir <- paste(outdir, "V_family", sep="/") -dir.create(diversity_dir) -dir.create(abundance_dir) dir.create(vfamily_dir) # Generate one big dataframe from all patient dataframes -df_list = lapply(all_files, read.csv, sep="\t") +df_list = lapply(all_files, read_rearrangement) df_all <- dplyr::bind_rows(df_list) -# Remove underscores in these columns -df_all$subject_id <- sapply(df_all$subject_id, function(x) str_replace(as.character(x), "_", "")) -df_all$sample_id <- sapply(df_all$sample_id, function(x) str_replace(as.character(x), "_", "")) +# Remove underscores in these columns (only needed if including clonal abundance and diversity) +df_all$subject_id <- stringr::str_replace_all(df_all$subject_id, "_", "") +df_all$sample_id <- stringr::str_replace_all(df_all$sample_id , "_", "") # Annotate sample and samplepop (sample + population) by add ing all the conditions df_all$subj_locus <- as.factor(paste(df_all$sample_id, df_all$subject_id, df_all$pcr_target_locus, sep="_")) -# Write table to file -write.table(df_all, paste0(outdir,"/all_data.tsv"), sep = "\t", quote=F, row.names = F, col.names = T) +# Uncomment to save a table with all the sequencess across samples together +# write.table(df_all, paste0(outdir,"/all_data.tsv"), sep = "\t", quote=F, row.names = F, col.names = T) # Set number of bootrstraps nboot = 200 ``` + + + +```{r clonal_abundance, echo=FALSE, eval=FALSE} +# Set line above to eval=TRUE to include clonal abundance +diversity_dir <- paste(outdir, "Diversity", sep="/") +abundance_dir <- paste(outdir, "Abundance", sep="/") +dir.create(diversity_dir) +dir.create(abundance_dir) + abund <- estimateAbundance(df_all, group = "subj_locus", ci=0.95, nboot=nboot) abund@abundance$sample_id <- sapply(abund@abundance$subj_locus, function(x) unlist(strsplit(as.character(x), "_"))[1]) abund@abundance$subject_id <- sapply(abund@abundance$subj_locus, function(x) unlist(strsplit(as.character(x), "_"))[2]) @@ -208,12 +207,14 @@ p_ca ``` -```{r plot_abundance, include = FALSE} +```{r plot_abundance, include = FALSE, eval=FALSE} +# Set to eval=TRUE to include clonal abundance ggsave(plot=p_ca, filename = paste0(abundance_dir,"/Clonal_abundance_subject.pdf"), device="pdf", width = 25, height = 10, units="cm") ggsave(plot=p_ca, filename = paste0(abundance_dir,"/Clonal_abundance_subject.png"), device="png", width = 25, height = 10, units="cm") write.table(abund@abundance, file = paste0(abundance_dir, "/Clonal_abundance_data_subject.tsv"), sep="\t", quote = F, row.names = F) ``` + - -```{r clonal_diversity, echo = FALSE} +```{r clonal_diversity, echo = FALSE, eval=FALSE} +# Set line above to eval=TRUE to include clonal diversity sample_div <- alphaDiversity(abund, group="subj_locus", min_q=0, max_q=4, step_q=0.05, ci=0.95, nboot=nboot) sample_main <- paste0("Sample diversity (N=", sample_div@n[1], ")") @@ -273,12 +275,14 @@ div_p <- ggplot(sample_div@diversity, aes(x = q, y = d, group=sample_id)) + div_p ``` -```{r plot_diversity, include = FALSE} +```{r plot_diversity, include = FALSE, eval=FALSE} +# Set to eval=TRUE to include clonal diversity ggsave(plot=div_p, filename=paste0(diversity_dir,"/Diversity_patient_grid.png"), device="png", width = 25, height = 10, units="cm") ggsave(plot=div_p, filename=paste0(diversity_dir,"/Diversity_patient_grid.pdf"), device="pdf", width = 25, height = 10, units="cm") write.table(sample_div@diversity, file = paste0(diversity_dir, "/Clonal_diversity_data_subject.tsv"), sep="\t", quote = F, row.names = F) ``` + # V gene usage ## V gene family usage From 716fc5e3b16f1eb315bd75a2e4e8c2de9826794d Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Tue, 20 Jun 2023 14:26:36 -0400 Subject: [PATCH 014/111] add samplesheet check assembled --- bin/check_samplesheet.py | 90 +++++++++++++++------ conf/modules.config | 10 +++ modules/local/samplesheet_check.nf | 3 +- subworkflows/local/assembled_input_check.nf | 4 +- 4 files changed, 81 insertions(+), 26 deletions(-) diff --git a/bin/check_samplesheet.py b/bin/check_samplesheet.py index a75fb3c5..478059bc 100755 --- a/bin/check_samplesheet.py +++ b/bin/check_samplesheet.py @@ -15,7 +15,8 @@ def parse_args(args=None): Epilog = "Example usage: python check_samplesheet.py " parser = argparse.ArgumentParser(description=Description, epilog=Epilog) - parser.add_argument("FILE_IN", help="Input samplesheet file.") + parser.add_argument("file_in", help="Input samplesheet file.") + parser.add_argument("-a", "--assembled", help="Input samplesheet type", action="store_true", default=False) return parser.parse_args(args) @@ -38,7 +39,7 @@ def print_error(error, context="Line", context_str=""): sys.exit(1) -def check_samplesheet(file_in): +def check_samplesheet(file_in, assembled): """ This function checks that the samplesheet: @@ -51,9 +52,10 @@ def check_samplesheet(file_in): sample_run_dict = {} with open(file_in, "r") as fin: - ## Check that required columns are present + + # Defining minimum columns and required columns min_cols = 7 - required_columns = [ + required_columns_raw = [ "sample_id", "filename_R1", "filename_R2", @@ -66,7 +68,19 @@ def check_samplesheet(file_in): "biomaterial_provider", "age", ] - no_whitespaces = [ + required_columns_assembled = [ + "sample_id", + "filename", + "subject_id", + "species", + "pcr_target_locus", + "single_cell", + "sex", + "tissue", + "biomaterial_provider", + "age", + ] + no_whitespaces_raw = [ "sample_id", "filename_R1", "filename_R2", @@ -75,13 +89,52 @@ def check_samplesheet(file_in): "pcr_target_locus", "tissue", ] + no_whitespaces_assembled = [ + "sample_id", + "filename", + "subject_id", + "species", + "pcr_target_locus", + "tissue", + ] + + ## Read header header = [x.strip('"') for x in fin.readline().strip().split("\t")] - for col in required_columns: - if col not in header: - print("ERROR: Please check samplesheet header: {} ".format(",".join(header))) - print("Header is missing column {}".format(col)) - print("Header must contain columns {}".format("\t".join(required_columns))) - raise IndexError("Header must contain columns {}".format("\t".join(required_columns))) + ## Read tab + tab = pd.read_csv(file_in, sep="\t", header=0) + + # Check that all required columns for assembled and raw samplesheets are there, and do not contain whitespaces + if assembled: + for col in required_columns_assembled: + if col not in header: + print("ERROR: Please check samplesheet header: {} ".format(",".join(header))) + print("Header is missing column {}".format(col)) + print("Header must contain columns {}".format("\t".join(required_columns))) + raise IndexError("Header must contain columns {}".format("\t".join(required_columns))) + for col in no_whitespaces_assembled: + values = tab[col].tolist() + if any([re.search(r"\s+", s) for s in values]): + print_error( + "The column {} contains values with whitespaces. Please ensure that there are no tabs, spaces or any other whitespaces in these columns as well: {}".format( + col, no_whitespaces + ) + ) + + else: + for col in required_columns_raw: + if col not in header: + print("ERROR: Please check samplesheet header: {} ".format(",".join(header))) + print("Header is missing column {}".format(col)) + print("Header must contain columns {}".format("\t".join(required_columns))) + raise IndexError("Header must contain columns {}".format("\t".join(required_columns))) + for col in no_whitespaces_raw: + values = tab[col].tolist() + if any([re.search(r"\s+", s) for s in values]): + print_error( + "The column {} contains values with whitespaces. Please ensure that there are no tabs, spaces or any other whitespaces in these columns as well: {}".format( + col, no_whitespaces + ) + ) ## Check that rows have the same fields as header, and at least the compulsory ones are provided for line_num, line in enumerate(fin): @@ -103,7 +156,6 @@ def check_samplesheet(file_in): ) ## Check that sample ids are unique - tab = pd.read_csv(file_in, sep="\t", header=0) if len(tab["sample_id"]) != len(set(tab["sample_id"])): print_error( "Sample IDs are not unique! The sample IDs in the input samplesheet should be unique for each sample." @@ -111,7 +163,7 @@ def check_samplesheet(file_in): ## Check that pcr_target_locus is IG or TR for val in tab["pcr_target_locus"]: - if val not in ["IG", "TR"]: + if val.upper() not in ["IG", "TR"]: print_error("pcr_target_locus must be one of: IG, TR.") ## Check that species is human or mouse @@ -129,20 +181,12 @@ def check_samplesheet(file_in): "The same subject_id cannot belong to different species! Check input file columns 'subject_id' and 'species'." ) - ## Check that values do not contain spaces in the no whitespaces columns - for col in no_whitespaces: - values = tab[col].tolist() - if any([re.search(r"\s+", s) for s in values]): - print_error( - "The column {} contains values with whitespaces. Please ensure that there are no tabs, spaces or any other whitespaces in these columns as well: {}".format( - col, no_whitespaces - ) - ) + def main(args=None): args = parse_args(args) - check_samplesheet(args.FILE_IN) + check_samplesheet(args.file_in, args.assembled) if __name__ == "__main__": diff --git a/conf/modules.config b/conf/modules.config index d16975a4..2203a65c 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -35,6 +35,16 @@ process { ] } + // Validate input assembled + withName: SAMPLESHEET_CHECK_ASSEMBLED { + publishDir = [ + path: { "${params.outdir}/pipeline_info" }, + mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename } + ] + ext.args = '--assembled' + } + withName: 'FASTP' { publishDir = [ [ diff --git a/modules/local/samplesheet_check.nf b/modules/local/samplesheet_check.nf index b9593c98..757851a7 100644 --- a/modules/local/samplesheet_check.nf +++ b/modules/local/samplesheet_check.nf @@ -18,8 +18,9 @@ process SAMPLESHEET_CHECK { task.ext.when == null || task.ext.when script: // This script is bundled with the pipeline, in nf-core/airrflow/bin/ + def args = task.ext.args ?: '' """ - check_samplesheet.py $samplesheet + check_samplesheet.py $samplesheet $args cp $samplesheet samplesheet.valid.tsv cat <<-END_VERSIONS > versions.yml diff --git a/subworkflows/local/assembled_input_check.nf b/subworkflows/local/assembled_input_check.nf index b37b359f..3b519c6f 100644 --- a/subworkflows/local/assembled_input_check.nf +++ b/subworkflows/local/assembled_input_check.nf @@ -3,6 +3,7 @@ */ include { VALIDATE_INPUT } from '../../modules/local/enchantr/validate_input' +include { SAMPLESHEET_CHECK as SAMPLESHEET_CHECK_ASSEMBLED } from '../../modules/local/samplesheet_check' workflow ASSEMBLED_INPUT_CHECK { take: @@ -12,8 +13,7 @@ workflow ASSEMBLED_INPUT_CHECK { cloneby main: - // TODO: validate input should check that sample_ids are unique - + SAMPLESHEET_CHECK_ASSEMBLED ( samplesheet ) VALIDATE_INPUT ( samplesheet, miairr, collapseby, cloneby ) //removed reassign ch_validated_input = VALIDATE_INPUT.out.validated_input ch_validated_input From b6c89e90f7dbcf2611bcff82029630bc7aee4f60 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Tue, 20 Jun 2023 14:41:12 -0400 Subject: [PATCH 015/111] fix black linting --- bin/check_samplesheet.py | 3 --- 1 file changed, 3 deletions(-) diff --git a/bin/check_samplesheet.py b/bin/check_samplesheet.py index 478059bc..87475e56 100755 --- a/bin/check_samplesheet.py +++ b/bin/check_samplesheet.py @@ -52,7 +52,6 @@ def check_samplesheet(file_in, assembled): sample_run_dict = {} with open(file_in, "r") as fin: - # Defining minimum columns and required columns min_cols = 7 required_columns_raw = [ @@ -182,8 +181,6 @@ def check_samplesheet(file_in, assembled): ) - - def main(args=None): args = parse_args(args) check_samplesheet(args.file_in, args.assembled) From db676779d77a746d0ef698444d2ea3a2b8c7a0a3 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Tue, 20 Jun 2023 14:42:09 -0400 Subject: [PATCH 016/111] back to dev version --- nextflow.config | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/nextflow.config b/nextflow.config index b25143ba..0f72f9dc 100644 --- a/nextflow.config +++ b/nextflow.config @@ -310,7 +310,7 @@ manifest { description = """B and T cell repertoire analysis pipeline with the Immcantation framework.""" mainScript = 'main.nf' nextflowVersion = '!>=22.10.1' - version = '3.1.0' + version = '3.2.0dev' doi = '10.5281/zenodo.2642009' } From c42be4f0315a4135ad2448a47e7bf7cc765f4273 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Tue, 20 Jun 2023 14:45:48 -0400 Subject: [PATCH 017/111] fix var name --- bin/check_samplesheet.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/bin/check_samplesheet.py b/bin/check_samplesheet.py index 87475e56..f3b10dc9 100755 --- a/bin/check_samplesheet.py +++ b/bin/check_samplesheet.py @@ -115,7 +115,7 @@ def check_samplesheet(file_in, assembled): if any([re.search(r"\s+", s) for s in values]): print_error( "The column {} contains values with whitespaces. Please ensure that there are no tabs, spaces or any other whitespaces in these columns as well: {}".format( - col, no_whitespaces + col, no_whitespaces_assembled ) ) @@ -131,7 +131,7 @@ def check_samplesheet(file_in, assembled): if any([re.search(r"\s+", s) for s in values]): print_error( "The column {} contains values with whitespaces. Please ensure that there are no tabs, spaces or any other whitespaces in these columns as well: {}".format( - col, no_whitespaces + col, no_whitespaces_raw ) ) From 39f34a59894f91a4c32786eba745ec6ed22fa861 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Tue, 20 Jun 2023 16:07:30 -0400 Subject: [PATCH 018/111] Update assets/repertoire_comparison.Rmd --- assets/repertoire_comparison.Rmd | 7 ++----- 1 file changed, 2 insertions(+), 5 deletions(-) diff --git a/assets/repertoire_comparison.Rmd b/assets/repertoire_comparison.Rmd index 54cb996f..39324048 100644 --- a/assets/repertoire_comparison.Rmd +++ b/assets/repertoire_comparison.Rmd @@ -170,11 +170,8 @@ df_all <- dplyr::bind_rows(lapply(all_files, ) # Remove underscores in these columns -# df_all$subject_id <- sapply(df_all$subject_id, function(x) str_replace(as.character(x), "_", "")) -df_all$subject_id <- stringi::stri_replace_first_fixed(df_all$subject_id, "_", "") - -# df_all$sample_id <- sapply(df_all$sample_id, function(x) str_replace(as.character(x), "_", "")) -df_all$sample_id <- stringi::stri_replace_first_fixed(df_all$sample_id, "_", "") +df_all$subject_id <- sapply(df_all$subject_id, function(x) str_replace(as.character(x), "_", "")) +df_all$sample_id <- sapply(df_all$sample_id, function(x) str_replace(as.character(x), "_", "")) # Annotate sample and samplepop (sample + population) by add ing all the conditions df_all$subj_locus <- as.factor(paste(df_all$sample_id, df_all$subject_id, df_all$pcr_target_locus, sep="_")) From 9490ce02f4efca87d1905b88113816f4f810d084 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Tue, 20 Jun 2023 16:07:35 -0400 Subject: [PATCH 019/111] Update assets/repertoire_comparison.Rmd --- assets/repertoire_comparison.Rmd | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/assets/repertoire_comparison.Rmd b/assets/repertoire_comparison.Rmd index 39324048..d75a2f81 100644 --- a/assets/repertoire_comparison.Rmd +++ b/assets/repertoire_comparison.Rmd @@ -29,7 +29,7 @@ library(dplyr) library(tidyr) library(alakazam) library(shazam) -library(stringi) +library(stringr) library(plotly) library(airr) From 402cb7f4edb6b4e44df73fc3db5f3900b3313544 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Wed, 21 Jun 2023 09:22:56 -0400 Subject: [PATCH 020/111] Add params findthreshold --- conf/modules.config | 5 +++++ 1 file changed, 5 insertions(+) diff --git a/conf/modules.config b/conf/modules.config index 2203a65c..6db8fe20 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -408,6 +408,11 @@ process { mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] + ext.args = ['findthreshold_method':'gmm', + 'findthreshold_model':'gamma-norm', + 'findthreshold_edge':0.9, + 'findthreshold_cutoff':'user', + 'findthreshold_spc':0.995] } withName: REPORT_THRESHOLD { From b53a6a19aaf8cbfa0f3a53f2ee463b9648478057 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Wed, 21 Jun 2023 09:33:47 -0400 Subject: [PATCH 021/111] update changelog --- CHANGELOG.md | 13 ++++++++++++- 1 file changed, 12 insertions(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index e7e1fd26..adda8a37 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,18 @@ The format is based on [Keep a Changelog](http://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0.html). -## [3.1] - 2023-06-05 "Protego" +## [3.2.0dev] - + +### `Added` + +- Added parameters for FindThreshold in `modules.config`. + +### `Fixed` + +### `Dependencies` + + +## [3.1.0] - 2023-06-05 "Protego" ### `Added` From f0862bc0cb6c971925088e4c7160e880af8aa13f Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Wed, 21 Jun 2023 16:30:04 +0200 Subject: [PATCH 022/111] species mix not allowed use a samplesheet per species --- ...embled.config => test_assembled_hs.config} | 2 +- ...st_assembled_immcantation_devel_hs.config} | 2 +- ...est_assembled_immcantation_devel_mm.config | 44 +++++++++++++++++++ conf/test_assembled_mm.config | 31 +++++++++++++ modules/local/enchantr/define_clones.nf | 1 + 5 files changed, 78 insertions(+), 2 deletions(-) rename conf/{test_assembled.config => test_assembled_hs.config} (94%) rename conf/{test_assembled_immcantation_devel.config => test_assembled_immcantation_devel_hs.config} (96%) create mode 100644 conf/test_assembled_immcantation_devel_mm.config create mode 100644 conf/test_assembled_mm.config diff --git a/conf/test_assembled.config b/conf/test_assembled_hs.config similarity index 94% rename from conf/test_assembled.config rename to conf/test_assembled_hs.config index 8d3e5e10..602f5462 100644 --- a/conf/test_assembled.config +++ b/conf/test_assembled_hs.config @@ -18,7 +18,7 @@ params { // Input data mode = 'assembled' - input = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/testdata-reveal/test_reveal_metadata.tsv' + input = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/testdata-reveal/test_assembled_metadata_hs.tsv' imgtdb_base = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/database-cache/imgtdb_base.zip' igblast_base = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/database-cache/igblast_base.zip' diff --git a/conf/test_assembled_immcantation_devel.config b/conf/test_assembled_immcantation_devel_hs.config similarity index 96% rename from conf/test_assembled_immcantation_devel.config rename to conf/test_assembled_immcantation_devel_hs.config index 61ddeeca..4d597614 100644 --- a/conf/test_assembled_immcantation_devel.config +++ b/conf/test_assembled_immcantation_devel_hs.config @@ -18,7 +18,7 @@ params { // Input data mode = 'assembled' - input = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/testdata-reveal/test_reveal_metadata.tsv' + input = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/testdata-reveal/test_assembled_metadata_hs.tsv' imgtdb_base = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/database-cache/imgtdb_base.zip' igblast_base = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/database-cache/igblast_base.zip' igphyml = '/usr/local/share/igphyml/src/igphyml' diff --git a/conf/test_assembled_immcantation_devel_mm.config b/conf/test_assembled_immcantation_devel_mm.config new file mode 100644 index 00000000..31766cd1 --- /dev/null +++ b/conf/test_assembled_immcantation_devel_mm.config @@ -0,0 +1,44 @@ +/* + * ------------------------------------------------- + * Nextflow config file for running tests + * ------------------------------------------------- + * Defines bundled input files and everything required + * to run a fast and simple test. Use as follows: + * nextflow run nf-core/airrflow -profile test_assembled_immcantation_devel, + */ + +params { + config_profile_name = 'Test assembled mode with Immcantation custom_container' + config_profile_description = 'Minimal test dataset to check pipeline function on assembled mode with Immcantation custom_container' + + // Limit resources so that this can run on GitHub Actions + max_cpus = 2 + max_memory = 6.GB + max_time = 6.h + + // Input data + mode = 'assembled' + input = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/testdata-reveal/test_assembled_metadata_mm.tsv' + imgtdb_base = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/database-cache/imgtdb_base.zip' + igblast_base = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/database-cache/igblast_base.zip' + igphyml = '/usr/local/share/igphyml/src/igphyml' + + reassign = true + productive_only = true + collapseby = 'filename' + cloneby = 'subject_id' + crossby = 'subject_id' + remove_chimeric = true +} + +process{ + + // all process with label 'immcantation' will be tested with this container instead. + withLabel:immcantation{ + container = 'docker.io/immcantation/suite:devel' + } +} + +env { + PYTHONNOUSERSITE = 0 +} diff --git a/conf/test_assembled_mm.config b/conf/test_assembled_mm.config new file mode 100644 index 00000000..97228f2f --- /dev/null +++ b/conf/test_assembled_mm.config @@ -0,0 +1,31 @@ +/* + * ------------------------------------------------- + * Nextflow config file for running tests + * ------------------------------------------------- + * Defines bundled input files and everything required + * to run a fast and simple test. Use as follows: + * nextflow run nf-core/airrflow -profile test, + */ + +params { + config_profile_name = 'Test assembled mode' + config_profile_description = 'Minimal test dataset to test assembled mode' + + // Limit resources so that this can run on GitHub Actions + max_cpus = 2 + max_memory = 6.GB + max_time = 6.h + + // Input data + mode = 'assembled' + input = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/testdata-reveal/test_assembled_metadata_mm.tsv' + imgtdb_base = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/database-cache/imgtdb_base.zip' + igblast_base = 'https://raw.githubusercontent.com/nf-core/test-datasets/airrflow/database-cache/igblast_base.zip' + + reassign = true + productive_only = true + collapseby = 'filename' + cloneby = 'subject_id' + remove_chimeric = true +} + diff --git a/modules/local/enchantr/define_clones.nf b/modules/local/enchantr/define_clones.nf index b8dc498c..ed7e9314 100644 --- a/modules/local/enchantr/define_clones.nf +++ b/modules/local/enchantr/define_clones.nf @@ -52,6 +52,7 @@ process DEFINE_CLONES { Rscript -e "enchantr::enchantr_report('define_clones', \\ report_params=list('input'='${input}', \\ 'imgt_db'='${imgt_base}', \\ + 'species'='auto', \\ 'cloneby'='${params.cloneby}', \\ 'force'=FALSE, \\ 'threshold'=${thr}, \\ From fb228decff7655e35e57a52a7a0f533be1416096 Mon Sep 17 00:00:00 2001 From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com> Date: Wed, 21 Jun 2023 16:42:17 +0200 Subject: [PATCH 023/111] updated confis and tests to use separate hs and mm --- .github/workflows/ci.yml | 2 +- .github/workflows/ci_immcantation.yml | 2 +- conf/test_assembled_immcantation_devel_hs.config | 4 ++-- conf/test_assembled_immcantation_devel_mm.config | 4 ++-- nextflow.config | 6 ++++-- 5 files changed, 10 insertions(+), 8 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index ddf7f1da..3e586322 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -48,7 +48,7 @@ jobs: NXF_VER: - "22.10.1" - "latest-everything" - profile: ["test_tcr", "test_no_umi", "test_nocluster", "test_fetchimgt", "test_assembled"] + profile: ["test_tcr", "test_no_umi", "test_nocluster", "test_fetchimgt", "test_assembled_hs", "test_assembled_mm"] fail-fast: false steps: - name: Check out pipeline code diff --git a/.github/workflows/ci_immcantation.yml b/.github/workflows/ci_immcantation.yml index 934bd81c..c01cacd5 100644 --- a/.github/workflows/ci_immcantation.yml +++ b/.github/workflows/ci_immcantation.yml @@ -25,7 +25,7 @@ jobs: NXF_VER: - "22.10.1" - "latest-everything" - profile: ["test_assembled_immcantation_devel", "test_raw_immcantation_devel"] + profile: ["test_assembled_immcantation_devel_hs", "test_assembled_immcantation_devel_mm", "test_raw_immcantation_devel"] fail-fast: false steps: - name: Check out pipeline code diff --git a/conf/test_assembled_immcantation_devel_hs.config b/conf/test_assembled_immcantation_devel_hs.config index 4d597614..dad18d47 100644 --- a/conf/test_assembled_immcantation_devel_hs.config +++ b/conf/test_assembled_immcantation_devel_hs.config @@ -4,12 +4,12 @@ * ------------------------------------------------- * Defines bundled input files and everything required * to run a fast and simple test. Use as follows: - * nextflow run nf-core/airrflow -profile test_assembled_immcantation_devel, + * nextflow run nf-core/airrflow -profile test_assembled_immcantation_hs_devel, */ params { config_profile_name = 'Test assembled mode with Immcantation custom_container' - config_profile_description = 'Minimal test dataset to check pipeline function on assembled mode with Immcantation custom_container' + config_profile_description = 'Minimal human test dataset to check pipeline function on assembled mode with Immcantation custom_container' // Limit resources so that this can run on GitHub Actions max_cpus = 2 diff --git a/conf/test_assembled_immcantation_devel_mm.config b/conf/test_assembled_immcantation_devel_mm.config index 31766cd1..2aea10a3 100644 --- a/conf/test_assembled_immcantation_devel_mm.config +++ b/conf/test_assembled_immcantation_devel_mm.config @@ -4,12 +4,12 @@ * ------------------------------------------------- * Defines bundled input files and everything required * to run a fast and simple test. Use as follows: - * nextflow run nf-core/airrflow -profile test_assembled_immcantation_devel, + * nextflow run nf-core/airrflow -profile test_assembled_immcantation_devel_mm, */ params { config_profile_name = 'Test assembled mode with Immcantation custom_container' - config_profile_description = 'Minimal test dataset to check pipeline function on assembled mode with Immcantation custom_container' + config_profile_description = 'Minimal mouse test dataset to check pipeline function on assembled mode with Immcantation custom_container' // Limit resources so that this can run on GitHub Actions max_cpus = 2 diff --git a/nextflow.config b/nextflow.config index b25143ba..b4fff8ac 100644 --- a/nextflow.config +++ b/nextflow.config @@ -255,9 +255,11 @@ profiles { test_full { includeConfig 'conf/test_full.config' } test_tcr { includeConfig 'conf/test_tcr.config' } test_no_umi { includeConfig 'conf/test_no_umi.config' } - test_assembled { includeConfig 'conf/test_assembled.config' } + test_assembled_hs { includeConfig 'conf/test_assembled_hs.config' } + test_assembled_mm { includeConfig 'conf/test_assembled_mm.config' } test_raw_immcantation_devel { includeConfig 'conf/test_raw_immcantation_devel.config' } - test_assembled_immcantation_devel { includeConfig 'conf/test_assembled_immcantation_devel.config' } + test_assembled_immcantation_devel_hs { includeConfig 'conf/test_assembled_immcantation_devel_hs.config' } + test_assembled_immcantation_devel_mm { includeConfig 'conf/test_assembled_immcantation_devel_mm.config' } test_nocluster { includeConfig 'conf/test_nocluster.config' } test_fetchimgt { includeConfig 'conf/test_fetchimgt.config' } test_igblast { includeConfig 'conf/test_igblast.config' } From 359c4b12d8985cda2e26a44cddb2ba00cc48c045 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Thu, 22 Jun 2023 13:17:17 -0400 Subject: [PATCH 024/111] enable convergence define clones report --- conf/modules.config | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/conf/modules.config b/conf/modules.config index 6db8fe20..1737a926 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -443,7 +443,7 @@ process { ] ext.args = ['outname':'', 'model':'hierarchical', 'method':'nt', 'linkage':'single', - 'skip_convergence':true, + 'skip_convergence':false, 'outputby':'sample_id', 'min_n':30] } From 2492a924058e7af9575242ff91a8a3e4d8e2b834 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Thu, 22 Jun 2023 14:07:04 -0400 Subject: [PATCH 025/111] fix prettier --- .github/workflows/ci.yml | 3 ++- .github/workflows/ci_immcantation.yml | 7 ++++++- 2 files changed, 8 insertions(+), 2 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 3e586322..11eab3db 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -48,7 +48,8 @@ jobs: NXF_VER: - "22.10.1" - "latest-everything" - profile: ["test_tcr", "test_no_umi", "test_nocluster", "test_fetchimgt", "test_assembled_hs", "test_assembled_mm"] + profile: + ["test_tcr", "test_no_umi", "test_nocluster", "test_fetchimgt", "test_assembled_hs", "test_assembled_mm"] fail-fast: false steps: - name: Check out pipeline code diff --git a/.github/workflows/ci_immcantation.yml b/.github/workflows/ci_immcantation.yml index c01cacd5..8669923d 100644 --- a/.github/workflows/ci_immcantation.yml +++ b/.github/workflows/ci_immcantation.yml @@ -25,7 +25,12 @@ jobs: NXF_VER: - "22.10.1" - "latest-everything" - profile: ["test_assembled_immcantation_devel_hs", "test_assembled_immcantation_devel_mm", "test_raw_immcantation_devel"] + profile: + [ + "test_assembled_immcantation_devel_hs", + "test_assembled_immcantation_devel_mm", + "test_raw_immcantation_devel", + ] fail-fast: false steps: - name: Check out pipeline code From 81a2e7081ec40c593c0cc668f0468559361661d3 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Thu, 22 Jun 2023 14:13:37 -0400 Subject: [PATCH 026/111] rm print in read tables report --- assets/repertoire_comparison.Rmd | 9 +-------- 1 file changed, 1 insertion(+), 8 deletions(-) diff --git a/assets/repertoire_comparison.Rmd b/assets/repertoire_comparison.Rmd index d75a2f81..59962623 100644 --- a/assets/repertoire_comparison.Rmd +++ b/assets/repertoire_comparison.Rmd @@ -160,14 +160,7 @@ col_select <- c( "junction", "pcr_target_locus" ) -i <- 0 -df_all <- dplyr::bind_rows(lapply(all_files, - function(x) { - i <<- i +1 - message("Loading file #",i,":",x) - read_rearrangement(x, col_select=col_select) - }) -) +df_all <- dplyr::bind_rows(lapply(all_files, read_rearrangement, col_select=col_select)) # Remove underscores in these columns df_all$subject_id <- sapply(df_all$subject_id, function(x) str_replace(as.character(x), "_", "")) From 4c82ace01793c73ee29227a97d2dd674cb672599 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Thu, 22 Jun 2023 14:35:39 -0400 Subject: [PATCH 027/111] fix mouse config --- conf/test_assembled_mm.config | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/conf/test_assembled_mm.config b/conf/test_assembled_mm.config index 97228f2f..a80d2099 100644 --- a/conf/test_assembled_mm.config +++ b/conf/test_assembled_mm.config @@ -9,7 +9,7 @@ params { config_profile_name = 'Test assembled mode' - config_profile_description = 'Minimal test dataset to test assembled mode' + config_profile_description = 'Minimal mouse test dataset to test assembled mode' // Limit resources so that this can run on GitHub Actions max_cpus = 2 From 56e4c8669bc2c707a250e74b740ceac9f4c52ac0 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Thu, 22 Jun 2023 15:00:38 -0400 Subject: [PATCH 028/111] allow for locus lowercase --- bin/check_samplesheet.py | 2 +- docs/usage.md | 7 +++---- modules/local/changeo/changeo_parsedb_select.nf | 4 ++-- 3 files changed, 6 insertions(+), 7 deletions(-) diff --git a/bin/check_samplesheet.py b/bin/check_samplesheet.py index f3b10dc9..bc686deb 100755 --- a/bin/check_samplesheet.py +++ b/bin/check_samplesheet.py @@ -46,7 +46,7 @@ def check_samplesheet(file_in, assembled): - contains the compulsory fields: sample_id, filename_R1, filename_R2, subject_id, pcr_target_locus, species, single_cell - sample ids are unique - samples from the same subject come from the same species - - pcr_target_locus is "IG" or "TR" + - pcr_target_locus is "IG"/"ig" or "TR"/"tr" - species is "human" or "mouse" """ diff --git a/docs/usage.md b/docs/usage.md index f7f4f931..54c692dd 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -111,15 +111,14 @@ The metadata specified in the input file will then be automatically annotated in ## Assembled input samplesheet (bulk or single-cell) -The required input file for processing raw BCR or TCR bulk targeted sequencing data is a sample sheet in TSV format (tab separated). The columns `sample_id`, `filename`, `subject_id`, `species`, `tissue`, `single_cell`, `sex`, `age` and `biomaterial_provider` are required. +The required input file for processing raw BCR or TCR bulk targeted sequencing data is a sample sheet in TSV format (tab separated). The columns `sample_id`, `filename`, `subject_id`, `species`, `tissue`, `single_cell`, `pcr_target_locus`, `sex`, `age` and `biomaterial_provider` are required. An example samplesheet is | filename | species | subject_id | sample_id | tissue | sex | age | biomaterial_provider | pcr_target_locus | single_cell | | -------------------------------------------------------- | ------- | ---------- | --------------------------------- | ---------- | ---- | --- | -------------------- | ---------------- | ----------- | -| sc5p_v2_hs_PBMC_1k_b_airr_rearrangement.tsv | human | subject_x | sc5p_v2_hs_PBMC_1k_5fb | PBMC | NA | NA | 10x Genomics | ig | TRUE | -| sc5p_v2_mm_c57bl6_splenocyte_1k_b_airr_rearrangement.tsv | mouse | mouse_x | sc5p_v2_mm_c57bl6_splenocyte_1k_b | splenocyte | NA | NA | 10x Genomics | ig | TRUE | -| bulk-Laserson-2014.fasta | human | PGP1 | PGP1 | PBMC | male | NA | Laserson-2014 | ig | FALSE | +| sc5p_v2_hs_PBMC_1k_b_airr_rearrangement.tsv | human | subject_x | sc5p_v2_hs_PBMC_1k_5fb | PBMC | NA | NA | 10x Genomics | IG | TRUE | +| bulk-Laserson-2014.fasta | human | PGP1 | PGP1 | PBMC | male | NA | Laserson-2014 | IG | FALSE | ## Supported AIRR metadata fields diff --git a/modules/local/changeo/changeo_parsedb_select.nf b/modules/local/changeo/changeo_parsedb_select.nf index 0bab80ab..9f592e7f 100644 --- a/modules/local/changeo/changeo_parsedb_select.nf +++ b/modules/local/changeo/changeo_parsedb_select.nf @@ -20,7 +20,7 @@ process CHANGEO_PARSEDB_SELECT { script: def args = task.ext.args ?: '' def args2 = task.ext.args2 ?: '' - if (meta.locus == 'IG'){ + if (meta.locus.toUpperCase() == 'IG'){ """ ParseDb.py select -d $tab $args --outname ${meta.id} > ${meta.id}_select_command_log.txt @@ -30,7 +30,7 @@ process CHANGEO_PARSEDB_SELECT { changeo: \$( ParseDb.py --version | awk -F' ' '{print \$2}' ) END_VERSIONS """ - } else if (meta.locus == 'TR'){ + } else if (meta.locus.toUpperCase() == 'TR'){ """ ParseDb.py select -d $tab $args2 --outname ${meta.id} > "${meta.id}_command_log.txt" From dfaff527741c8f9ef86902e2d55dc96bec589f55 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Thu, 22 Jun 2023 15:04:24 -0400 Subject: [PATCH 029/111] fix linting --- .github/workflows/ci.yml | 3 ++- .github/workflows/ci_immcantation.yml | 7 ++++++- CHANGELOG.md | 1 - 3 files changed, 8 insertions(+), 3 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 3e586322..11eab3db 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -48,7 +48,8 @@ jobs: NXF_VER: - "22.10.1" - "latest-everything" - profile: ["test_tcr", "test_no_umi", "test_nocluster", "test_fetchimgt", "test_assembled_hs", "test_assembled_mm"] + profile: + ["test_tcr", "test_no_umi", "test_nocluster", "test_fetchimgt", "test_assembled_hs", "test_assembled_mm"] fail-fast: false steps: - name: Check out pipeline code diff --git a/.github/workflows/ci_immcantation.yml b/.github/workflows/ci_immcantation.yml index c01cacd5..8669923d 100644 --- a/.github/workflows/ci_immcantation.yml +++ b/.github/workflows/ci_immcantation.yml @@ -25,7 +25,12 @@ jobs: NXF_VER: - "22.10.1" - "latest-everything" - profile: ["test_assembled_immcantation_devel_hs", "test_assembled_immcantation_devel_mm", "test_raw_immcantation_devel"] + profile: + [ + "test_assembled_immcantation_devel_hs", + "test_assembled_immcantation_devel_mm", + "test_raw_immcantation_devel", + ] fail-fast: false steps: - name: Check out pipeline code diff --git a/CHANGELOG.md b/CHANGELOG.md index adda8a37..c47dc1a8 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -13,7 +13,6 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0. ### `Dependencies` - ## [3.1.0] - 2023-06-05 "Protego" ### `Added` From 074c4f532baa98d7f0dfb8026be22586580920e6 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Thu, 22 Jun 2023 15:08:17 -0400 Subject: [PATCH 030/111] update changelog --- CHANGELOG.md | 5 ++++- 1 file changed, 4 insertions(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index c47dc1a8..d34d1fec 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -7,10 +7,13 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0. ### `Added` -- Added parameters for FindThreshold in `modules.config`. +- [#268](https://github.com/nf-core/airrflow/pull/268) Added parameters for FindThreshold in `modules.config`. +- [#268](https://github.com/nf-core/airrflow/pull/268) Validate samplesheet also for `assembled` samplesheet. ### `Fixed` +- [#268](https://github.com/nf-core/airrflow/pull/268) Allows for uppercase and lowercase locus in samplesheet `pcr_target_locus`. + ### `Dependencies` ## [3.1.0] - 2023-06-05 "Protego" From 9bcef93c5b3d42cdee09a5f7983576a1794beee4 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Thu, 22 Jun 2023 15:09:14 -0400 Subject: [PATCH 031/111] fix linting --- docs/usage.md | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/docs/usage.md b/docs/usage.md index 54c692dd..e54b10f8 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -115,10 +115,10 @@ The required input file for processing raw BCR or TCR bulk targeted sequencing d An example samplesheet is -| filename | species | subject_id | sample_id | tissue | sex | age | biomaterial_provider | pcr_target_locus | single_cell | -| -------------------------------------------------------- | ------- | ---------- | --------------------------------- | ---------- | ---- | --- | -------------------- | ---------------- | ----------- | -| sc5p_v2_hs_PBMC_1k_b_airr_rearrangement.tsv | human | subject_x | sc5p_v2_hs_PBMC_1k_5fb | PBMC | NA | NA | 10x Genomics | IG | TRUE | -| bulk-Laserson-2014.fasta | human | PGP1 | PGP1 | PBMC | male | NA | Laserson-2014 | IG | FALSE | +| filename | species | subject_id | sample_id | tissue | sex | age | biomaterial_provider | pcr_target_locus | single_cell | +| ------------------------------------------- | ------- | ---------- | ---------------------- | ------ | ---- | --- | -------------------- | ---------------- | ----------- | +| sc5p_v2_hs_PBMC_1k_b_airr_rearrangement.tsv | human | subject_x | sc5p_v2_hs_PBMC_1k_5fb | PBMC | NA | NA | 10x Genomics | IG | TRUE | +| bulk-Laserson-2014.fasta | human | PGP1 | PGP1 | PBMC | male | NA | Laserson-2014 | IG | FALSE | ## Supported AIRR metadata fields From e7478840e68b7e65582b113ce814c2c855ef6dfb Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Fri, 23 Jun 2023 09:27:00 -0400 Subject: [PATCH 032/111] update to enchantr 0.1.3 --- modules/local/airrflow_report/airrflow_report.nf | 6 +++--- modules/local/enchantr/collapse_duplicates.nf | 6 +++--- modules/local/enchantr/define_clones.nf | 6 +++--- modules/local/enchantr/detect_contamination.nf | 6 +++--- modules/local/enchantr/dowser_lineages.nf | 6 +++--- modules/local/enchantr/find_threshold.nf | 6 +++--- modules/local/enchantr/remove_chimeric.nf | 6 +++--- modules/local/enchantr/report_file_size.nf | 6 +++--- modules/local/enchantr/single_cell_qc.nf | 6 +++--- modules/local/enchantr/validate_input.nf | 6 +++--- modules/local/reveal/add_meta_to_tab.nf | 6 +++--- modules/local/reveal/filter_junction_mod3.nf | 6 +++--- modules/local/reveal/filter_quality.nf | 6 +++--- 13 files changed, 39 insertions(+), 39 deletions(-) diff --git a/modules/local/airrflow_report/airrflow_report.nf b/modules/local/airrflow_report/airrflow_report.nf index 5b6113de..10996b6e 100644 --- a/modules/local/airrflow_report/airrflow_report.nf +++ b/modules/local/airrflow_report/airrflow_report.nf @@ -2,10 +2,10 @@ process AIRRFLOW_REPORT { tag "${meta.id}" label 'process_high' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: tuple val(meta), path(tab) // sequence tsv table in AIRR format diff --git a/modules/local/enchantr/collapse_duplicates.nf b/modules/local/enchantr/collapse_duplicates.nf index e1c117a9..2257913f 100644 --- a/modules/local/enchantr/collapse_duplicates.nf +++ b/modules/local/enchantr/collapse_duplicates.nf @@ -4,10 +4,10 @@ process COLLAPSE_DUPLICATES { label 'process_long_parallelized' label 'immcantation' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: tuple val(meta), path(tabs) // tuple [val(meta), sequence tsv in AIRR format ] diff --git a/modules/local/enchantr/define_clones.nf b/modules/local/enchantr/define_clones.nf index ed7e9314..7321603a 100644 --- a/modules/local/enchantr/define_clones.nf +++ b/modules/local/enchantr/define_clones.nf @@ -21,10 +21,10 @@ process DEFINE_CLONES { label 'process_long_parallelized' label 'immcantation' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: tuple val(meta), path(tabs) // meta, sequence tsv in AIRR format diff --git a/modules/local/enchantr/detect_contamination.nf b/modules/local/enchantr/detect_contamination.nf index 38308003..003c2126 100644 --- a/modules/local/enchantr/detect_contamination.nf +++ b/modules/local/enchantr/detect_contamination.nf @@ -5,10 +5,10 @@ process DETECT_CONTAMINATION { label 'immcantation' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: path(tabs) diff --git a/modules/local/enchantr/dowser_lineages.nf b/modules/local/enchantr/dowser_lineages.nf index e74c5e64..2e398f58 100644 --- a/modules/local/enchantr/dowser_lineages.nf +++ b/modules/local/enchantr/dowser_lineages.nf @@ -21,10 +21,10 @@ process DOWSER_LINEAGES { label 'process_long_parallelized' label 'immcantation' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: tuple val(meta), path(tabs) diff --git a/modules/local/enchantr/find_threshold.nf b/modules/local/enchantr/find_threshold.nf index 643958db..32ff652e 100644 --- a/modules/local/enchantr/find_threshold.nf +++ b/modules/local/enchantr/find_threshold.nf @@ -21,10 +21,10 @@ process FIND_THRESHOLD { label 'process_long_parallelized' label 'immcantation' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: diff --git a/modules/local/enchantr/remove_chimeric.nf b/modules/local/enchantr/remove_chimeric.nf index 59a4e3a5..41467ecb 100644 --- a/modules/local/enchantr/remove_chimeric.nf +++ b/modules/local/enchantr/remove_chimeric.nf @@ -5,10 +5,10 @@ process REMOVE_CHIMERIC { label 'immcantation' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: diff --git a/modules/local/enchantr/report_file_size.nf b/modules/local/enchantr/report_file_size.nf index ca6f6825..c9a2052c 100644 --- a/modules/local/enchantr/report_file_size.nf +++ b/modules/local/enchantr/report_file_size.nf @@ -6,10 +6,10 @@ process REPORT_FILE_SIZE { label 'immcantation' label 'process_single' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: path logs diff --git a/modules/local/enchantr/single_cell_qc.nf b/modules/local/enchantr/single_cell_qc.nf index 87422b86..3275c523 100644 --- a/modules/local/enchantr/single_cell_qc.nf +++ b/modules/local/enchantr/single_cell_qc.nf @@ -20,10 +20,10 @@ process SINGLE_CELL_QC { label 'immcantation' label 'process_medium' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: path(tabs) diff --git a/modules/local/enchantr/validate_input.nf b/modules/local/enchantr/validate_input.nf index 5be240c6..fd6bd345 100644 --- a/modules/local/enchantr/validate_input.nf +++ b/modules/local/enchantr/validate_input.nf @@ -6,10 +6,10 @@ process VALIDATE_INPUT { label 'immcantation' label 'process_single' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: file samplesheet diff --git a/modules/local/reveal/add_meta_to_tab.nf b/modules/local/reveal/add_meta_to_tab.nf index 3e9da456..f24433e2 100644 --- a/modules/local/reveal/add_meta_to_tab.nf +++ b/modules/local/reveal/add_meta_to_tab.nf @@ -3,10 +3,10 @@ process ADD_META_TO_TAB { label 'immcantation' label 'process_single' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" cache 'deep' // Without 'deep' this process would run when using -resume diff --git a/modules/local/reveal/filter_junction_mod3.nf b/modules/local/reveal/filter_junction_mod3.nf index ff6021ff..841fbba9 100644 --- a/modules/local/reveal/filter_junction_mod3.nf +++ b/modules/local/reveal/filter_junction_mod3.nf @@ -3,10 +3,10 @@ process FILTER_JUNCTION_MOD3 { label 'immcantation' label 'process_single' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: tuple val(meta), path(tab) // sequence tsv in AIRR format diff --git a/modules/local/reveal/filter_quality.nf b/modules/local/reveal/filter_quality.nf index 39c6e2d2..a649caef 100644 --- a/modules/local/reveal/filter_quality.nf +++ b/modules/local/reveal/filter_quality.nf @@ -3,10 +3,10 @@ process FILTER_QUALITY { label 'immcantation' label 'process_single' - conda "bioconda::r-enchantr=0.1.2" + conda "bioconda::r-enchantr=0.1.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.2--r42hdfd78af_0': - 'biocontainers/r-enchantr:0.1.2--r42hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0': + 'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }" input: tuple val(meta), path(tab) // sequence tsv in AIRR format From 9746d8e82ead87ef2ae0276ec61647e67c946abe Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Fri, 23 Jun 2023 09:31:06 -0400 Subject: [PATCH 033/111] update changelog --- CHANGELOG.md | 7 +++++++ 1 file changed, 7 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index d34d1fec..13adb86f 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -9,13 +9,20 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0. - [#268](https://github.com/nf-core/airrflow/pull/268) Added parameters for FindThreshold in `modules.config`. - [#268](https://github.com/nf-core/airrflow/pull/268) Validate samplesheet also for `assembled` samplesheet. +- [#259](https://github.com/nf-core/airrflow/pull/259) Update to `EnchantR v0.1.3`. ### `Fixed` - [#268](https://github.com/nf-core/airrflow/pull/268) Allows for uppercase and lowercase locus in samplesheet `pcr_target_locus`. +- [#259](https://github.com/nf-core/airrflow/pull/259) Samplesheet only allows data from one species. +- [#259](https://github.com/nf-core/airrflow/pull/259) Introduced fix for a too long command with hundreds of datasets. ### `Dependencies` +| Dependency | Old version | New version | +| ---------- | ----------- | ----------- | +| r-enchantr | 0.1.2 | 0.1.3 | + ## [3.1.0] - 2023-06-05 "Protego" ### `Added` From 9e8fb7418976efe8ef74bf3957327d1235f78b2c Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Fri, 23 Jun 2023 10:48:25 -0400 Subject: [PATCH 034/111] update readme --- README.md | 26 ++++++++++++++++++-------- 1 file changed, 18 insertions(+), 8 deletions(-) diff --git a/README.md b/README.md index 443b9933..63d2f522 100644 --- a/README.md +++ b/README.md @@ -15,7 +15,7 @@ ## Introduction -** nf-core/airrflow ** is a bioinformatics best-practice pipeline to analyze B-cell or T-cell repertoire sequencing data. It makes use of the [Immcantation](https://immcantation.readthedocs.io) toolset. The input data can be targeted amplicon bulk sequencing data of the V, D, J and C regions of the B/T-cell receptor with multiplex PCR or 5' RACE protocol, or assembled reads (bulk or single cell). +**nf-core/airrflow** is a bioinformatics best-practice pipeline to analyze B-cell or T-cell repertoire sequencing data. It makes use of the [Immcantation](https://immcantation.readthedocs.io) toolset. The input data can be targeted amplicon bulk sequencing data of the V, D, J and C regions of the B/T-cell receptor with multiplex PCR or 5' RACE protocol, or assembled reads (bulk or single cell). ![nf-core/airrflow overview](docs/images/airrflow_workflow_overview.png) @@ -87,7 +87,7 @@ First, ensure that the pipeline tests run on your infrastructure: nextflow run nf-core/airrflow -profile test, --outdir ``` -To run on your data, prepare a tab-separated samplesheet with your input data. Depending on the input data type (bulk or single-cell, raw reads or assembled reads) the input samplesheet will vary. Please follow the [documentation on samplesheets](https://nf-co.re/airrflow/usage#input-samplesheet) for more details. An example samplesheet for running the pipeline on raw BCR / TCR sequencing data looks as follows: +To run nf-core/airrflow with your data, prepare a tab-separated samplesheet with your input data. Depending on the input data type (bulk or single-cell, raw reads or assembled reads) the input samplesheet will vary. Please follow the [documentation on samplesheets](https://nf-co.re/airrflow/usage#input-samplesheet) for more details. An example samplesheet for running the pipeline on bulk BCR / TCR sequencing data in fastq format looks as follows: | sample_id | filename_R1 | filename_R2 | filename_I1 | subject_id | species | pcr_target_locus | tissue | sex | age | biomaterial_provider | single_cell | intervention | collection_time_point_relative | cell_subset | | --------- | ------------------------------- | ------------------------------- | ------------------------------- | ---------- | ------- | ---------------- | ------ | ------ | --- | -------------------- | ----------- | -------------- | ------------------------------ | ------------ | @@ -96,28 +96,38 @@ To run on your data, prepare a tab-separated samplesheet with your input data. D Each row represents a sample with fastq files (paired-end). -A typical command to run the pipeline is: +A typical command to run the pipeline from **bulk raw fastq files** is: ```bash nextflow run nf-core/airrflow \ -profile \ ---input samplesheet.tsv \ +--mode fastq \ +--input input_samplesheet.tsv \ --library_generation_method specific_pcr_umi \ --cprimers CPrimers.fasta \ --vprimers VPrimers.fasta \ --umi_length 12 \ ---max_memory 8.GB \ ---max_cpus 8 \ +--umi_position R1 \ --outdir ./results ``` +A typical command to run the pipeline from **single-cell AIRR rearrangement tables or assembled bulk sequencing fasta** data is: + +```bash +nextflow run nf-core/airrflow \ +-profile \ +--input input_samplesheet.tsv \ +--mode assembled \ +--outdir results +``` + +See the [usage documentation](https://nf-co.re/airrflow/usage) and the [parameter documentation](https://nf-co.re/airrflow/parameters) for more details on how to use the pipeline and all the available parameters. + > **Warning:** > Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those > provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; > see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). -For more details, please refer to the [usage documentation](https://nf-co.re/airrflow/usage) and the [parameter documentation](https://nf-co.re/airrflow/parameters). - ## Pipeline output To see the the results of a test run with a full size dataset refer to the [results](https://nf-co.re/airrflow/results) tab on the nf-core website pipeline page. From 1b5b0b8cc75320ab705ef34938ba6fb748f04867 Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Fri, 23 Jun 2023 10:48:46 -0400 Subject: [PATCH 035/111] usage docs more specific about assembled subworkflow --- docs/usage.md | 152 ++++++++++++++++++++++++++------------------------ 1 file changed, 79 insertions(+), 73 deletions(-) diff --git a/docs/usage.md b/docs/usage.md index f7f4f931..4d2a4498 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -12,33 +12,31 @@ The nf-core/airrflow pipeline allows processing BCR and TCR targeted sequencing # Running the pipeline -The typical command for running the pipeline departing from bulk raw fastq files is as follows: +## Quickstart + +A typical command for running the pipeline for **bulk raw fastq files** is: ```bash nextflow run nf-core/airrflow \ --profile docker \ +-profile \ --mode fastq \ ---input samplesheet.tsv \ +--input input_samplesheet.tsv \ --library_generation_method specific_pcr_umi \ --cprimers CPrimers.fasta \ --vprimers VPrimers.fasta \ --umi_length 12 \ ---max_memory 8.GB \ ---max_cpus 8 \ ---outdir ./results +--umi_position R1 \ +--outdir results ``` -The typical command for running the pipeline departing from assembled reads (fasta) or single-cell data (AIRR) is as follows: +A typical command for running the pipeline departing from **single-cell AIRR rearrangement tables or assembled bulk sequencing fasta** data is: -``` +```bash nextflow run nf-core/airrflow \ --profile docker \ +-profile \ --input input_samplesheet.tsv \ --mode assembled \ ---outdir results \ ---reassign --productive_only --remove_chimeric \ ---collapseby filename \ ---cloneby subject_id +--outdir results ``` For more information about the parameters, please refer to the [parameters documentation](https://nf-co.re/airrflow/parameters). @@ -76,9 +74,9 @@ input: 'data' You can also generate such `YAML`/`JSON` files via [nf-core/launch](https://nf-co.re/launch). -# Input samplesheet +## Input samplesheet -## Fastq input samplesheet (bulk) +### Fastq input samplesheet (bulk sequencing only) The required input file for processing raw BCR or TCR bulk targeted sequencing data is a sample sheet in TSV format (tab separated). The columns `sample_id`, `filename_R1`, `filename_R2`, `subject_id`, `species`, `tissue`, `pcr_target_locus`, `single_cell`, `sex`, `age` and `biomaterial_provider` are required. An example samplesheet is: @@ -87,41 +85,47 @@ The required input file for processing raw BCR or TCR bulk targeted sequencing d | sample01 | sample1_S8_L001_R1_001.fastq.gz | sample1_S8_L001_R2_001.fastq.gz | sample1_S8_L001_I1_001.fastq.gz | Subject02 | human | IG | blood | NA | 53 | sequencing_facility | FALSE | Drug_treatment | Baseline | plasmablasts | | sample02 | sample2_S8_L001_R1_001.fastq.gz | sample2_S8_L001_R2_001.fastq.gz | sample2_S8_L001_I1_001.fastq.gz | Subject02 | human | TR | blood | female | 78 | sequencing_facility | FALSE | Drug_treatment | Baseline | plasmablasts | -- sample_id: Sample ID assigned by submitter, unique within study. -- filename_R1: path to fastq file with first mates of paired-end sequencing. -- filename_R2: path to fastq file with second mates of paired-end sequencing. -- filename_I1 (optional): path to fastq with illumina index and UMI (unique molecular identifier) barcode. -- subject_id: Subject ID assigned by submitter, unique within study. -- species: species from which the sample was taken. Supported species are `human` and `mouse`. -- tissue: tissue from which the sample was taken. E.g. `blood`, `PBMC`, `brain`. -- pcr_target_locus: Designation of the target locus (`IG` or `TR`). -- sex: Subject biological sex (`female`, `male`, etc.). -- age: Subject biological age. -- single_cell: TRUE or FALSE. Fastq input samplesheet only supports a FALSE value. +- `sample_id`: Sample ID assigned by submitter, unique within study. +- `filename_R1`: path to fastq file with first mates of paired-end sequencing. +- `filename_R2`: path to fastq file with second mates of paired-end sequencing. +- `filename_I1` (optional): path to fastq with illumina index and UMI (unique molecular identifier) barcode. +- `subject_id`: Subject ID assigned by submitter, unique within study. +- `species`: species from which the sample was taken. Supported species are `human` and `mouse`. +- `tissue`: tissue from which the sample was taken. E.g. `blood`, `PBMC`, `brain`. +- `pcr_target_locus`: Designation of the target locus (`IG` or `TR`). +- `biomaterial_provider`: Institution / research group that provided the samples. +- `sex`: Subject biological sex (`female`, `male`, etc.). +- `age`: Subject biological age. +- `single_cell`: TRUE or FALSE. Fastq input samplesheet only supports a FALSE value. Other optional columns can be added. These columns will be available when building the contrasts for the repertoire comparison report. It is recommended that these columns also follow the AIRR nomenclature. Examples are: -- intervention: Description of intervention. -- disease_diagnosis: Diagnosis of subject. -- collection_time_point_relative: Time point at which sample was taken, relative to `collection_time_point_reference` (e.g. 14d, 6 months, baseline). -- collection_time_point_reference: Event in the study schedule to which `Sample collection time` relates to (e.g. primary vaccination, intervention start). -- cell_subset: Commonly-used designation of isolated cell population. +- `intervention`: Description of intervention. +- `disease_diagnosis`: Diagnosis of subject. +- `collection_time_point_relative`: Time point at which sample was taken, relative to `collection_time_point_reference` (e.g. 14d, 6 months, baseline). +- `collection_time_point_reference`: Event in the study schedule to which `Sample collection time` relates to (e.g. primary vaccination, intervention start). +- `cell_subset`: Commonly-used designation of isolated cell population. The metadata specified in the input file will then be automatically annotated in a column with the same header in the tables generated by the pipeline. -## Assembled input samplesheet (bulk or single-cell) +### Assembled input samplesheet (bulk or single-cell sequencing) + +The required input file for processing raw BCR or TCR bulk targeted sequencing data is a sample sheet in TSV format (tab separated). The columns `sample_id`, `filename`, `subject_id`, `species`, `tissue`, `single_cell`, `sex`, `age` and `biomaterial_provider` are required. All fields are explained in the previous section, with the only difference being that there is only one `filename` column for the assembled input samplesheet. The provided file will be different from assembled single-cell or bulk data: + +- `filename` for single-cell assembled data: path to `airr_rearrangement.tsv` file, for example the one generated when processing the 10x Genomics scBCRseq / scTCRseq with 10x Genomics cellranger `cellranger vdj` or `cellranger multi`. The field accepts any tsv tables following the [AIRR rearrangement Schema specification](https://docs.airr-community.org/en/stable/datarep/rearrangements.html). See [here](https://support.10xgenomics.com/single-cell-vdj/software/pipelines/latest/output/annotation#airr) for more details on the cellranger output. +- `filename` for bulk assembled data: path to `sequences.fasta` file, containing the assembled and error-corrected reads. + -The required input file for processing raw BCR or TCR bulk targeted sequencing data is a sample sheet in TSV format (tab separated). The columns `sample_id`, `filename`, `subject_id`, `species`, `tissue`, `single_cell`, `sex`, `age` and `biomaterial_provider` are required. +Assembled bulk and single-cell sequencing data can be processed in the same run and can be provided in the same samplesheet as shown below. -An example samplesheet is +An example samplesheet is: | filename | species | subject_id | sample_id | tissue | sex | age | biomaterial_provider | pcr_target_locus | single_cell | | -------------------------------------------------------- | ------- | ---------- | --------------------------------- | ---------- | ---- | --- | -------------------- | ---------------- | ----------- | -| sc5p_v2_hs_PBMC_1k_b_airr_rearrangement.tsv | human | subject_x | sc5p_v2_hs_PBMC_1k_5fb | PBMC | NA | NA | 10x Genomics | ig | TRUE | -| sc5p_v2_mm_c57bl6_splenocyte_1k_b_airr_rearrangement.tsv | mouse | mouse_x | sc5p_v2_mm_c57bl6_splenocyte_1k_b | splenocyte | NA | NA | 10x Genomics | ig | TRUE | -| bulk-Laserson-2014.fasta | human | PGP1 | PGP1 | PBMC | male | NA | Laserson-2014 | ig | FALSE | +| sc5p_v2_hs_PBMC_1k_b_airr_rearrangement.tsv | human | subject_x | sc5p_v2_hs_PBMC_1k_5fb | PBMC | NA | NA | 10x Genomics | IG | TRUE | +| bulk-Laserson-2014.fasta | human | PGP1 | PGP1 | PBMC | male | NA | Laserson-2014 | IG | FALSE | -## Supported AIRR metadata fields +### Supported AIRR metadata fields nf-core/airrflow offers full support for the [AIRR standards 1.4](https://docs.airr-community.org/en/stable/datarep/metadata.html) metadata annotation. The minimum metadata fields that are needed by the pipeline are listed in the table below. Other non-mandatory AIRR fields can be provided in the input samplesheet, which will be available for reporting and introducing comparisons among repertoires. @@ -137,7 +141,7 @@ nf-core/airrflow offers full support for the [AIRR standards 1.4](https://docs.a | biomaterial_provider | Samplesheet column | | Name of sample biomaterial provider | | library_generation_method | Parameter | `--library_generation_method` | Generic type of library generation | -# Supported bulk library generation methods (protocols) +## Supported bulk library generation methods (protocols) When processing bulk sequencing data departing from raw `fastq` reads, several sequencing protocols are supported which can be provided with the parameter `--library_generation_method`. The following table matches the library generation methods as described in the [AIRR metadata annotation guidelines](https://docs.airr-community.org/en/stable/miairr/metadata_guidelines.html#library-generation-method) to the value that can be provided to the `--library_generation_method` parameter. @@ -155,13 +159,13 @@ The following table matches the library generation methods as described in the [ | RT(specific+UMI)+TS+PCR | 5’-RACE PCR using transcript- specific primers containing UMIs | Not supported | | | RT(specific)+TS | RT-based generation of dsDNA without subsequent PCR. This is used by RNA-seq kits. | Not supported | | -## Multiplex specific PCR (with or without UMI) +### Multiplex specific PCR (with or without UMI) This sequencing type requires setting `--library_generation_method specific_pcr_umi` if UMI barcodes were used, or `--library_generation_method specific_pcr` if no UMI barcodes were used (sans-umi). If the option without UMI barcodes is selected, the UMI length will be set automatically to 0. It is required to provide the sequences for the V-region primers as well as the C-region primers used in the specific PCR amplification. Some examples of UMI and barcode configurations are provided. Depending on the position of the C-region primer, V-region primers and UMI barcodes, there are several possibilities detailed in the following subsections. -### R1 read contains C primer (and UMI barcode) +#### R1 read contains C primer (and UMI barcode) The `--cprimer_position` and `--umi_position` (if UMIs are used) parameters need to be set to R1 (this is the default). If there are extra bases between the UMI barcode and C primer, specify the number of bases with the `--cprimer_start` parameter (default zero). Set `--cprimer_position R1` (this is the default). @@ -194,7 +198,7 @@ nextflow run nf-core/airrflow -profile docker \ --outdir ./results ``` -### R1 read contains V primer (and UMI barcode) +#### R1 read contains V primer (and UMI barcode) The `--umi_position` parameter needs to be set to R1 (if UMIs are used), and `--cprimer_position` to `R2`. If there are extra bases between the UMI barcode and V primer, specify the number of bases with the `--vprimer_start` parameter (default zero). @@ -227,7 +231,7 @@ nextflow run nf-core/airrflow -profile docker \ --outdir results ``` -### R2 read contains C primer (and UMI barcode) +#### R2 read contains C primer (and UMI barcode) The `--umi_position` and `--cprimer_position` parameters need to be set to R2. If there are extra bases between the UMI barcode and C primer, specify the number of bases with the `--cprimer_start` parameter (default zero). @@ -247,7 +251,7 @@ nextflow run nf-core/airrflow -profile docker \ --outdir ./results ``` -### UMI barcode is provided in the index file +#### UMI barcode is provided in the index file If the UMI barcodes are provided in an additional index file, please provide it in the column `filename_I1` in the input samplesheet and additionally set the `--index_file` parameter. Specify the UMI barcode length with the `--umi_length` parameter. You can optionally specify the UMI start position in the index sequence with the `--umi_start` parameter (the default is 0). @@ -266,11 +270,11 @@ nextflow run nf-core/airrflow -profile docker \ --outdir ./results ``` -## dT-Oligo RT and 5'RACE PCR +### dT-Oligo RT and 5'RACE PCR This sequencing type requires setting `--library_generation_method race_5p_umi` or `--library_generation_method race_5p_umi` if UMIs are not being employed, and providing sequences for the C-region primers as well as the linker or template switch oligo sequences with the parameter `--race_linker`. Examples are provided below to run airrflow to process amplicons generated with the TAKARA 5'RACE SMARTer Human BCR and TCR protocols (library structure schema shown below). -### Takara Bio SMARTer Human BCR +#### Takara Bio SMARTer Human BCR The read configuration when sequenicng with the TAKARA Bio SMARTer Human BCR protocol is the following: @@ -289,7 +293,7 @@ nextflow run nf-core/airrflow -profile docker \ --outdir ./results ``` -### Takara Bio SMARTer Human TCR v2 +#### Takara Bio SMARTer Human TCR v2 The read configuration when sequencing with the Takara Bio SMARTer Human TCR v2 protocol is the following: @@ -328,7 +332,7 @@ GTTTGGTATGAGGCTGACTTCN CATCTGCATCAAGTTGTTTATC ``` -# UMI barcode handling +## UMI barcode handling Unique Molecular Identifiers (UMIs) enable the quantification of BCR or TCR abundance in the original sample by allowing to distinguish PCR duplicates from original sample duplicates. The UMI indices are random nucleotide sequences of a pre-determined length that are added to the sequencing libraries before any PCR amplification steps, for example as part of the primer sequences. @@ -361,7 +365,7 @@ To further assist in reproducibility, you can use share and re-use [parameter fi > 💡 If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles. -## Core Nextflow arguments +# Core Nextflow arguments > **NB:** These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen). @@ -398,37 +402,55 @@ If `-profile` is not specified, the pipeline will run locally and expect all sof - `conda` - A generic configuration profile to be used with [Conda](https://conda.io/docs/). Please only use Conda as a last resort i.e. when it's not possible to run the pipeline with Docker, Singularity, Podman, Shifter, Charliecloud, or Apptainer. -### `-resume` +## `-resume` Specify this when restarting a pipeline. Nextflow will use cached results from any pipeline steps where the inputs are the same, continuing from where it got to previously. For input to be considered the same, not only the names must be identical but the files' contents as well. For more info about this parameter, see [this blog post](https://www.nextflow.io/blog/2019/demystifying-nextflow-resume.html). You can also supply a run name to resume a specific run: `-resume [run-name]`. Use the `nextflow log` command to show previous run names. -### `-c` +## `-c` Specify the path to a specific config file (this is a core Nextflow command). See the [nf-core website documentation](https://nf-co.re/usage/configuration) for more information. -## Custom configuration +## Nextflow memory requirements + +In some cases, the Nextflow Java virtual machines can start to request a large amount of memory. +We recommend adding the following line to your environment to limit this (typically in `~/.bashrc` or `~./bash_profile`): + +```bash +NXF_OPTS='-Xms1g -Xmx4g' +``` + +## Running in the background + +Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished. + +The Nextflow `-bg` flag launches Nextflow in the background, detached from your terminal so that the workflow does not stop if you log out of your session. The logs are saved to a file. + +Alternatively, you can use `screen` / `tmux` or similar tool to create a detached session which you can log back into at a later time. +Some HPC setups also allow you to run nextflow within a cluster job submitted your job scheduler (from where it submits more jobs). -### Resource requests +# Custom configuration + +## Resource requests Whilst the default requirements set within the pipeline will hopefully work for most people and with most input data, you may find that you want to customise the compute resources that the pipeline requests. Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the steps in the pipeline, if the job exits with any of the error codes specified [here](https://github.com/nf-core/rnaseq/blob/4c27ef5610c87db00c3c5a3eed10b1d161abf575/conf/base.config#L18) it will automatically be resubmitted with higher requests (2 x original, then 3 x original). If it still fails after the third attempt then the pipeline execution is stopped. To change the resource requests, please see the [max resources](https://nf-co.re/docs/usage/configuration#max-resources) and [tuning workflow resources](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources) section of the nf-core website. -### Custom Containers +## Custom Containers -In some cases you may wish to change which container or conda environment a step of the pipeline uses for a particular tool. By default nf-core pipelines use containers and software from the [biocontainers](https://biocontainers.pro/) or [bioconda](https://bioconda.github.io/) projects. However in some cases the pipeline specified version maybe out of date. +In some cases you may wish to change which container or conda environment a step of the pipeline uses for a particular tool. By default nf-core pipelines use containers and software from the [biocontainers](https://biocontainers.pro/) or [bioconda](https://bioconda.github.io/) projects. However in some cases the pipeline specified version may be out of date. To use a different container from the default container or conda environment specified in a pipeline, please see the [updating tool versions](https://nf-co.re/docs/usage/configuration#updating-tool-versions) section of the nf-core website. -### Custom Tool Arguments +## Custom Tool Arguments A pipeline might not always support every possible argument or option of a particular tool used in pipeline. Fortunately, nf-core pipelines provide some freedom to users to insert additional parameters that the pipeline does not include by default. To learn how to provide additional arguments to a particular tool of the pipeline, please see the [customising tool arguments](https://nf-co.re/docs/usage/configuration#customising-tool-arguments) section of the nf-core website. -### nf-core/configs +## nf-core/configs In most cases, you will only need to create a custom config as a one-off but if you and others within your organisation are likely to be running nf-core pipelines regularly and need to use the same settings regularly it may be a good idea to request that your custom config file is uploaded to the `nf-core/configs` git repository. Before you do this please can you test that the config file works with your pipeline of choice using the `-c` parameter. You can then create a pull request to the `nf-core/configs` repository with the addition of your config file, associated documentation file (see examples in [`nf-core/configs/docs`](https://github.com/nf-core/configs/tree/master/docs)), and amending [`nfcore_custom.config`](https://github.com/nf-core/configs/blob/master/nfcore_custom.config) to include your custom profile. @@ -436,20 +458,4 @@ See the main [Nextflow documentation](https://www.nextflow.io/docs/latest/config If you have any questions or issues please send us a message on [Slack](https://nf-co.re/join/slack) on the [`#configs` channel](https://nfcore.slack.com/channels/configs). -## Running in the background - -Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished. - -The Nextflow `-bg` flag launches Nextflow in the background, detached from your terminal so that the workflow does not stop if you log out of your session. The logs are saved to a file. -Alternatively, you can use `screen` / `tmux` or similar tool to create a detached session which you can log back into at a later time. -Some HPC setups also allow you to run nextflow within a cluster job submitted your job scheduler (from where it submits more jobs). - -## Nextflow memory requirements - -In some cases, the Nextflow Java virtual machines can start to request a large amount of memory. -We recommend adding the following line to your environment to limit this (typically in `~/.bashrc` or `~./bash_profile`): - -```bash -NXF_OPTS='-Xms1g -Xmx4g' -``` From 9ec2002bc5f03746165b4e2e1183ebc96dc0326d Mon Sep 17 00:00:00 2001 From: Gisela Gabernet Date: Fri, 23 Jun 2023 10:52:02 -0400 Subject: [PATCH 036/111] Update assets/repertoire_comparison.Rmd --- assets/repertoire_comparison.Rmd | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/assets/repertoire_comparison.Rmd b/assets/repertoire_comparison.Rmd index b1c84944..64d51a89 100644 --- a/assets/repertoire_comparison.Rmd +++ b/assets/repertoire_comparison.Rmd @@ -150,7 +150,7 @@ col_select <- c( df_all <- dplyr::bind_rows(lapply(all_files, read_rearrangement, col_select=col_select)) -# Remove underscores in these columns (only needed if including clonal abundance and diversity) +# Remove underscores in these columns df_all$subject_id <- stringr::str_replace_all(df_all$subject_id, "_", "") df_all$sample_id <- stringr::str_replace_all(df_all$sample_id , "_", "") From 5d1ea048425ad38bf6861b042de3c8fd948a66bf Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Fri, 30 Jun 2023 16:12:43 +0000 Subject: [PATCH 037/111] Template update for nf-core/tools version 2.9 --- .github/CONTRIBUTING.md | 1 - .github/ISSUE_TEMPLATE/bug_report.yml | 2 +- .github/workflows/awsfulltest.yml | 11 +- .github/workflows/awstest.yml | 10 +- .github/workflows/ci.yml | 2 +- .gitpod.yml | 5 + CHANGELOG.md | 2 +- CITATIONS.md | 6 + README.md | 6 +- assets/methods_description_template.yml | 12 +- assets/multiqc_config.yml | 4 +- assets/nf-core-airrflow_logo_light.png | Bin 10534 -> 70812 bytes assets/slackreport.json | 2 +- conf/test_full.config | 2 - docs/usage.md | 6 +- lib/NfcoreSchema.groovy | 530 ------------------------ lib/NfcoreTemplate.groovy | 2 +- lib/WorkflowAirrflow.groovy | 45 +- lib/WorkflowMain.groovy | 37 -- main.nf | 16 + nextflow.config | 54 ++- nextflow_schema.json | 36 +- workflows/airrflow.nf | 25 +- 23 files changed, 177 insertions(+), 639 deletions(-) delete mode 100755 lib/NfcoreSchema.groovy diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index efebe9e0..5cb3103c 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -116,4 +116,3 @@ To get started: Devcontainer specs: - [DevContainer config](.devcontainer/devcontainer.json) -- [Dockerfile](.devcontainer/Dockerfile) diff --git a/.github/ISSUE_TEMPLATE/bug_report.yml b/.github/ISSUE_TEMPLATE/bug_report.yml index f2e98962..b0260675 100644 --- a/.github/ISSUE_TEMPLATE/bug_report.yml +++ b/.github/ISSUE_TEMPLATE/bug_report.yml @@ -42,7 +42,7 @@ body: attributes: label: System information description: | - * Nextflow version _(eg. 22.10.1)_ + * Nextflow version _(eg. 23.04.0)_ * Hardware _(eg. HPC, Desktop, Cloud)_ * Executor _(eg. slurm, local, awsbatch)_ * Container engine: _(e.g. Docker, Singularity, Conda, Podman, Shifter, Charliecloud, or Apptainer)_ diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index 8f3f758a..4918c9d9 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -14,7 +14,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Launch workflow via tower - uses: seqeralabs/action-tower-launch@v1 + uses: seqeralabs/action-tower-launch@v2 # TODO nf-core: You can customise AWS full pipeline tests as required # Add full size test data (but still relatively small datasets for few samples) # on the `test_full.config` test runs with only one set of parameters @@ -22,13 +22,18 @@ jobs: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} + revision: ${{ github.sha }} workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/airrflow/work-${{ github.sha }} parameters: | { + "hook_url": "${{ secrets.MEGATESTS_ALERTS_SLACK_HOOK_URL }}", "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/airrflow/results-${{ github.sha }}" } - profiles: test_full,aws_tower + profiles: test_full + - uses: actions/upload-artifact@v3 with: name: Tower debug log file - path: tower_action_*.log + path: | + tower_action_*.log + tower_action_*.json diff --git a/.github/workflows/awstest.yml b/.github/workflows/awstest.yml index 64fb9141..269c6875 100644 --- a/.github/workflows/awstest.yml +++ b/.github/workflows/awstest.yml @@ -12,18 +12,22 @@ jobs: steps: # Launch workflow using Tower CLI tool action - name: Launch workflow via tower - uses: seqeralabs/action-tower-launch@v1 + uses: seqeralabs/action-tower-launch@v2 with: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} + revision: ${{ github.sha }} workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/airrflow/work-${{ github.sha }} parameters: | { "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/airrflow/results-test-${{ github.sha }}" } - profiles: test,aws_tower + profiles: test + - uses: actions/upload-artifact@v3 with: name: Tower debug log file - path: tower_action_*.log + path: | + tower_action_*.log + tower_action_*.json diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 6c28fa5b..34dd6616 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -24,7 +24,7 @@ jobs: strategy: matrix: NXF_VER: - - "22.10.1" + - "23.04.0" - "latest-everything" steps: - name: Check out pipeline code diff --git a/.gitpod.yml b/.gitpod.yml index 85d95ecc..25488dcc 100644 --- a/.gitpod.yml +++ b/.gitpod.yml @@ -1,4 +1,9 @@ image: nfcore/gitpod:latest +tasks: + - name: Update Nextflow and setup pre-commit + command: | + pre-commit install --install-hooks + nextflow self-update vscode: extensions: # based on nf-core.nf-core-extensionpack diff --git a/CHANGELOG.md b/CHANGELOG.md index ab3352c4..cd4fd023 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## v3.0 - [date] +## v3.1.0 - [date] Initial release of nf-core/airrflow, created with the [nf-core](https://nf-co.re/) template. diff --git a/CITATIONS.md b/CITATIONS.md index b0f5c3db..7ba186a8 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -12,7 +12,10 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) + > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. Available online https://www.bioinformatics.babraham.ac.uk/projects/fastqc/. + - [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) + > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. ## Software packaging/containerisation tools @@ -31,5 +34,8 @@ - [Docker](https://dl.acm.org/doi/10.5555/2600239.2600241) + > Merkel, D. (2014). Docker: lightweight linux containers for consistent development and deployment. Linux Journal, 2014(239), 2. doi: 10.5555/2600239.2600241. + - [Singularity](https://pubmed.ncbi.nlm.nih.gov/28494014/) + > Kurtzer GM, Sochat V, Bauer MW. Singularity: Scientific containers for mobility of compute. PLoS One. 2017 May 11;12(5):e0177459. doi: 10.1371/journal.pone.0177459. eCollection 2017. PubMed PMID: 28494014; PubMed Central PMCID: PMC5426675. diff --git a/README.md b/README.md index 5ab676d9..6a23f938 100644 --- a/README.md +++ b/README.md @@ -2,7 +2,7 @@ [![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/airrflow/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX) -[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A522.10.1-23aa62.svg)](https://www.nextflow.io/) +[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/) [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/) [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/) @@ -66,11 +66,11 @@ nextflow run nf-core/airrflow \ > provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; > see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). -For more details, please refer to the [usage documentation](https://nf-co.re/airrflow/usage) and the [parameter documentation](https://nf-co.re/airrflow/parameters). +For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/airrflow/usage) and the [parameter documentation](https://nf-co.re/airrflow/parameters). ## Pipeline output -To see the the results of a test run with a full size dataset refer to the [results](https://nf-co.re/airrflow/results) tab on the nf-core website pipeline page. +To see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/airrflow/results) tab on the nf-core website pipeline page. For more details about the output files and reports, please refer to the [output documentation](https://nf-co.re/airrflow/output). diff --git a/assets/methods_description_template.yml b/assets/methods_description_template.yml index 4b9bedf5..e4acf864 100644 --- a/assets/methods_description_template.yml +++ b/assets/methods_description_template.yml @@ -3,17 +3,21 @@ description: "Suggested text and references to use when describing pipeline usag section_name: "nf-core/airrflow Methods Description" section_href: "https://github.com/nf-core/airrflow" plot_type: "html" -## TODO nf-core: Update the HTML below to your prefered methods description, e.g. add publication citation for this pipeline +## TODO nf-core: Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline ## You inject any metadata in the Nextflow '${workflow}' object data: |

Methods

-

Data was processed using nf-core/airrflow v${workflow.manifest.version} ${doi_text} of the nf-core collection of workflows (Ewels et al., 2020).

+

Data was processed using nf-core/airrflow v${workflow.manifest.version} ${doi_text} of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v${workflow.nextflow.version} (Di Tommaso et al., 2017) with the following command:

${workflow.commandLine}
+

${tool_citations}

References

    -
  • Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. https://doi.org/10.1038/nbt.3820
    • -
  • Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. https://doi.org/10.1038/s41587-020-0439-x
    • +
  • Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
    • +
  • Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
    • +
  • Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
    • +
  • da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192
    • + ${tool_bibliography}
Notes:
diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index c980e3f2..393a88b0 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -1,7 +1,7 @@ report_comment: > - This report has been generated by the nf-core/airrflow + This report has been generated by the nf-core/airrflow analysis pipeline. For information about how to interpret these results, please see the - documentation. + documentation. report_section_order: "nf-core-airrflow-methods-description": order: -1000 diff --git a/assets/nf-core-airrflow_logo_light.png b/assets/nf-core-airrflow_logo_light.png index bf5a851832a4c482cd34ce46f467ec6e63028bfa..2c7265f71aa121af916f24c4e5e93b9d982444f8 100644 GIT binary patch literal 70812 zcmeEt`9IX_`~RRQS?ZKSWhn*~p=96c5GGq9OZHNfecuPCQz(&w!1jG0qM))u18{N;szxKLnntC7*Z0~7*=;B1!jv^4p5Gb_^hQ29NgTYTSd@O|5 zS3HI44fR<@BwC_WweNAg^K`t?ay|Ua^`zuS;o*5X;p5j0nLR_3TdTw-*C$<<{Vk$; z9`%au>-b1%=CCl=x~!Jp!Br{RFpzjKp!3X+Tb;*QRKss@Kb){h^c+@seV?p-3zMBT zv9)Zlu({<`v3Pc z_~QTk@G~L)&kz6ShyTBGp!b^mFYH1%8g&}PE+NMRdy{Rgwkaa9QvrRQY2HJz)6`6H z9;J$!8p?T$p0J;N*Ye!J#ykH8M)iUCxVX5E!@pK|Rzc1t45Gxe-2E^GvsRWhY(8G+ zqQw!LH!;zIl^)J$8$X^IcCItbD!;xEnF(K*M&+X@JSfW~(%%?AjAD}I{FvT)!b;+< zT`3RVvHyDV#tr{F?pFSzX|tN{P8k1QHN6RI-9sVD@-lUEm%l0Eg`Uqb{CpIznVgoC zqUmmd=@Irb{U+;BnnF@S4JpEd=f8=bxA|}L4A?vsm9JMY?xEj%PSrz{(B9T6zCrD{ z5aNCa{cB^cli-wq*o{Dpv7Lu_ua|VKlQa68K&C3~Q72#9XybNMzba}b4=Acza~8q2n+%iDoFDn0jDk39X?^7A)!^mJ;E z5ekGVYdquWg)k>J@LX5^<&$Ub>jptvS20#izP!}h(}bdq;~{4o<`Z~-?Z6?eBvmOx zsE#!^me;!Al9p_BB9-oh+Bc@3zYqDCn3hx{MhJ+VI+>dJOaT*E;koA-_dUK}Uzf&# zH;{fF7_10)<{MQM8t=)+Bc#9Hzz?%a`@_R0){SISt$Kn@K8L}>h6mZ|Sq!BZKB@H20kftU}^PiE` z)c*Xdd@3S@t0+sw_uO~aLtzgUG2d;xQ1Q*1H#0qHdV%)wP1#8svyWz%C}A74L_x?B3pf9H&Y@2X=|G$}7iYO?E5Lr+QZ zunjfr@njOx!!AI9VRd9th^kl#?3g$t5Dxfn?H4g>K($Nt+fHaOY#hv@QlJIXl)td!4Cw33#odkl6Y zV>S|OhL=y33;S(CMLA9S@}2)++OhBFrXf0zRg_T_+T~HTPwd7xJV6cPBJX{fB~&hK zs$Fc?B(tfBkrDJu$X3Q1{1zTNRk(@T;z!+JtsYJ#VQFEI95Bp+1d)p+`Gk3TG-5Wg zkhB!>_0%li8!7wS)(5l@KDF!}dm%NoRf{a39g|I_D;7#><0*1`M%3kp01AB_Dq!Zg z8ht}kcgMfVhs)|`f(tl+ixNr3KYnoDKRVH}!H24qCWtT&%xd}zW+opB3MoDNJ0-8f zNvx7d#yy3T+j3B!o%L;!;b>EGDQXB~+h}0EX^k<%)ZBpGVwTz%Bc=Z{6LNVVmQ)Zs z#qHX&f?Rw4S8Pz4H6Vlw2CL`ph1rxV>T3%^&1h1dBkPo8>RjJw|7HE<#P4E!4_OE` zO$@0HI!7pPZx!b@3)8f7f(6Vl`(n8hAxh@*>=H@8QQ)g9oK9SqBFr%3t$}fQ3U0|& zMTUI5{BLzyt1e{`H?CqHGJTzP#T38;zV<;^=nNbG6N-_k!KrUQDx)Z|AC(bG|5a8Z zB*H@M#uON%NKm+sWqkHO`)aB@we3grs9;DMV?Q{%PqLj~`hASTUIF*q`ZO5WR)wVFI`G?Zxevi{$Td5LndKR;aC(U=|9wR~L8w;+zr-%IHsbY> zUgGTk{6DWrVb zYX7qj`>+ae$t5+}$|T_!B3=Erhn`P}k1ai*^PzUqmU{4eDXuat%oMLHRxej$e~5m@ z@ADVp?D3O)y6!#xyXd$s{yrf~zYM$Yrd~^{xM%^*VgG&MleV6Y&|SUNwG!INi~rl; z<-XXdqpn!99)UghSN}nCVm|NOx&~&TmiGceJ?{6R>laTmSZ>pxJbelcMsk4R0F=Ar(?q*%!}BhZw%+9K`8y{Yh!MT%%c;Bib&k(wxLRjmW=N{ro zoje;XgQ^~##P@&C)S#ViS*=Lu%Jg6vf7wA7B1zehn!53h9Ut=hiFVdZ2A1)BWO+Or zT}sR*gJqqhOx-8b1SCR0`&Ue?BhO8gDxoY*R=fY z+Cyn|_k)xr7Y`wB{C-T)JdQ-^IL_#4Kt|xti;{O2Uif`>)vlM+z~WAes&vp2#~e;> zaP#^zhn)Ghwj{nES?XIu)mFnEPiGi7&MHYgMRFdBqLYyRcM0|3NrSwRzt{zDC$Q16 z*lJ*$9KIG@s!K*lv(_p8gm-n5bjuuJKPNIbLluNw9-=Anc+g>>{ftA1)Liqyomg7G z0lZGlRAqUVOzOE5hF~nSdqkDH#ahTn%b<|fSG~?U$lf?xD}R^!j=>M6H8HyWF6y2} zPGPZ%iKNdTp7uW4JWgAQE8vm;X_WJc)Enn#$({*pabQ-s4krlc*`UTUP?m@IrR(4uk6XT&bDN%A5aA~}3fQZ}+Rd6c3 z*IAG-N{$P(j4Q>Srfr2tpV8=0h{!#~3-AoOv!u9tWom_0YBxR+7|^?x3!H1(U)HeMcJvM;GiZDK%TC8~?<`}ApK9*l&Oz?(AV;afU?!7R7^1E3 zn(zjAZ>L6+)k_BZ;z(Js8zvb4U#rVK@}KTN_B?4j^DOxi6XO26e;wx5>Meq@OeH16 zPKhP&D9lsS_dDnqJvA_TPayL?T-&Eo4MaN$Vsh~LOFAw$sP98vj^)e3erB(Ix)0Ed zcRcmT-^mAK97kIoOzJos^3BBIn=oowuyWRsVNp-Q8QI%4?47^vYmBj55kB(7-5G-Jw=*jed)*MV}zlKa?!7quxNI9Dqv5~0*qxF{ z-|ays&_rj1kTx$F^uK@^zBGGr$N8@D5U_4!fjHEh%d}?#HzMqS1VBYf&^KYut?s3z z#x(Dl-G0}fkFA#VYCT#)Cajcq(Xx9}P9Gs}$ynv!cB`zU=s>7GEmrr*<+Gsc;!_6q z1=Fl1&esa#1l?YLx5t#zFs9X%$7g7LW1T&4gw?plYc~G0M)WlGL4fi~%|d=l{ONR0 z(ExtJ#m(uPIko8AUgyCi5<6xC?H?P${GQ>p{S!2bzAysv+#gde=;uWi-SN!d&Z0cl z=Vxa<6L=w~xspnfYZmT}S`g$EU~=c)X2)i+nZgjfLi{{7BR9A9V@M?IiAzae66wR{ zbVBUFuw%J$iY49n2)JM4(tQT$^3x(BBAJp1iSJ3%-4{`4VM1nRNn{A0Wy;eaWAc95 zmX5rTQxA~AmcS{swE)2-o_n~AHzPLsJI(%{&@RtXp}uWD?G!-#W|yZ}HlXQ(*l93tqTy}~zd~*$CAgPi|Hx9G?WY5}M z02i&|#Gzt|tMhtL2iunNy9`lKjcFtdl5U(c0=}qQSucG4Onn{mfpPuC~ zUODq^;@FC~c)^rubE~#vvhN#etKRV16JtlmZIYdM@X)Bpn0CtGAJ@B}v82Whya624 zAWNK=gJR5mxMhoFA9d`R9<}|+y@96bmehO5?J{6J#mA%^uw=C3g0&=Yhgqk{lD6Pl zA2MNCrS_F=zGQJRW^*O@TbhT;+S9Ov8I?CaYg*B%^XJm?+K0UD#yYZ6KNnk=2?@=p zc=mdfEVeY#XB$fMFMFYgxxJ-=GENxkH(mxUP$i=}qjnpYz~jsE$`XWx{Ko z{su~~zYEKQH!jQXa{LphLJz|!xE7Bz&XW0HhkW@%MrHfMT?G}tx!TNXzI;CFJ5KS| z+d?rqica4@b;u}fj(?1w;vxQs=2i$^nPv}O^2q1a?fY1*LTE(|m4YKGJh`lI0QgB5 zLd7Q`gSl>EmtO3M%k!8F{Q_tbt)Q?GgUEKEQ{K}&yDmX?P&-6cwO7Pf5_I02N$U;D z^>}L)h~66K!L}xBeQR1XE4$^_To%#xacxYw<_$IFVFHr~HRaRStq6wUxxh^9K{nwv zGSbBg62eHHrLdO9f=R$peChd;#blkTAnf=uz@z{+E z09mH;dkVd2@B;WHFHWdCk-9TsY`B4HF0mG@Y0w_n%lfxep=Py_`>pF8HAic zI5>Dzt5K|fzC3L9WK7<5F*_$RAK>TKRTAWIyYol#>f`FxkO*AF7vCO4Eh?p$q_x59cLmsMlbT+}V zaI|PtAk*V&lNx5bTV?I&R}u~D-glvDnrJQ!d9;*d={1AV_H|(ab9o^1DGx zEg*8wH=cWZ&jMWl(Bb3=VVJ2CsbSv&R{t)jDfS@mUP+~{)vZwNT@_+ChG}txxpgN5 zoEUkoKQHx6+acPT(tX;P1!#WopOG#Ay=mGdgRh0xa7Yzn`F)du8^WH4JELXyeXy9XZNETOysflQOlCGBF*;iJnGrL6%1H`;Ol5>#tPMvU^qdFg6f+ zJ15{3Uw%mDwl9BEHY@WzC}z+7&<^JkfyR=ThRTwkPyL*}H=xoj`;$p= zzvcr(!zV$+TpgsJOE5~&Iu_a!B5G-Szdsm3JB-9Fv?8G!dg;0Im|<{;?oNIT>Mw_u zc)4N9LGY&l#N!Pr@+CYtT`7<%?rS-11^B9A3X|D zz`k>awRwQ!@Zpjy&@Rq`BKE}8fF_hR1+je_VFF#Pw4WYkP`_+9>`NqEb*gHg1zKK# z9$UEbB;f-%d{2K8i4zlOMLs6c2Alex9lj=y7xD?ln8j|GV)T%Ht{_O8$oT_~^dpxb zh6WP}2HLBBFTy$k4vuWXZp^LOJN}+>so%B{$y?m^&t!i3t`;ZptDkukl%4!I;I-4amD{4_C|db zZO)L6QpS)3z?ueRT_Op~KDooYukNekjPxi;Afr7!vZ@W`8FH7KQEehTFy}6Xhdg}Bj%BxLhz^5<=~ zrJ&XZ1!n?b)vw=MrncjT`pUz!c7_Mm_2vn-!H_(%@uWNm`l$j4BYD3>1G>f&!KDEh zuXthGF+96Nj(Oc46AUNoKh0wc3yq*^&k*k3OQ%^>h~DYB_{L#K11?8(IF=tl4VlX` zMOG$&kXWFZlMd!&o2S^Ck@w$&+a4-RQxde8 zhGZVKLiQTS?|R%5$A%c8!MMTUp3#~rR4ufb%a_T=gv~&9CX$k42Q1}xh5@QxJ5-Se zO<11i9!(6?i7+79&@ktMc#3qHQhSn3jY# zn()HALZ!onAgu|0NiBT3VTe(OOFYa_MqYyO+Igr4F>MH!VT0Sdb_l2_5AA)BkRplz zY67NS#Pi%uH)8<~6fiX}J=utEmR9nJ$b(Slx}(J%bj-eu-&-8ZJ$G2ML6xQA zAn$*S1b*Nrux5H7vK9w{fGcQ-XFC?hb{WqE`jYR|FDtK<7QdrH5269ZQVSZR5JsC% zYD*y4oDl33NA7(pbp}7Lf=ANz3oMdIKMMhB_~RphsVuLXpoz@ncSX`BrMlA2&3=Le zr=R#GVf5O_Xw@XE`ka;gE+ojMDkPy4EYh2}2^PujSTtg^Dwjxl`x8^S*#Bo-a)~MA z>X3;%V(y9P{#itTa%OHjdaY7hm6%u0FA6rueZa!(z z55fR4_!W(|Y)7QOjkW(ASX(RZ05^mIM!wMa#KRYB6NL2nLt0$|L~%@$H13UkWcF=r z`R6Sb*U{lvTj&`WWK&2m$Hbo+Hj_uVHq@qrle~7EG{CIF^po4H9ib5MAw#`nF)#2a zskzw?mkZ`ZT3m&w({4j*Y3f&}v`ym3{rX>ST8FkF4wX+EYy#6Da?BGl^l2ksF*uF_ zSf~FIiseqVB)Xk7I-U)Z3xPLz)#r(2_XdOp+Q|V>M&R-JqC5!o-U^;CyNQJ96Fkol z0ui+IH8F;9L=Cclw!91!P9v0{6Ux$3o=Kw61;|qUDTx1^F2F78u$?LlqwQc#!YOyj z3wao0qG>yrwC#IMe%(Q5{p2e7gCJtkB>*DP;%-TMG&e^bSEfYxsr6E4u8>&@`vA)k zxdcFVEn&Lu2qsQM&ZGW+Xv1=NzHkVxy8(U~=QJ_fFaS@1l%flfx{Z7aNx5?ikptdu z{Iz(pIxZe5Lz~Z)10m7UbOc0FEs_(8Gq;xm5{Y)7VO{DbvU5p+_xE>uE!9gj!Iaau z%TFIXWBQcl8QS$m&d-|+{G1^WoC~bS1nb3WC$J$>;x_+XN(!O`AFjVa!rEXG5`K;b zLkucjdLoFq=2sw)uk#>uh1rhcpfy5-0i{s0rF|25=m!O-h2=Vit8$brH`j`EeQw`? zL6`I+b)0m}!FGYHzOt7qDQX zIS6n~695KoovaVSl!6c;GgU4mm$Y?s0f=D8&_)T~62QOo>)(U|a=<8| zmh<}3Vo5buv9oOvSK7;t4{f@qTbfzW%O{eaBbhLPRl$D5)gGw(des^iu6^*W01VD= zV`SCyCXV!F^g(CP^s5eD;YpQ(DVV+nE2t1WsC?LjMo#~>30v%zN7F=bEEDaTetXht zD1o#E_J1y^GsUSdbxb#c*pR9T1iLgE)cIhl2K;)5od|btFs`W=y+@_Ni2Go$G z@Q{h=CgX5+t#?(wO8mjy&(d?s1W;^(en=qu=JwRZH31Ya4A+#T-}62FOj(4Ize6K}@W6YZr^?Dem#2jOqCXeRmww! zGoXHbb(q>X%pi-d^xzQ?UExb;e0Y9E7+$IvUKF2wG*%JQ^{QuCsPZgsEN-9sivbU` z^o-vqspl3owq}(i0*$Rkr}*|_c^%3<0OR+;sp0(+>IjV)o+Gz$AOr8Yi18q}9&GBb zhCVk~4W$D)%R_z?rKpk>Y~a!^-}tp}xLZErW@WFlQsU52v7F)kHR6QLkLPa`e7PWu zP*($;n`-Gse6jdZF{fFHdOy&oao;`%FPORU1nYRZVCpQF<}Y*}i+P1BV@o7}St8x_r>2-9wNP;M8 zcD9UX^E6p$%+jaBD+&%Za`9O#c7)A0(g;|qKb}NcWL6&jTBlfN|LX0O_N>=8LS}~s zEG>-LxD6U{;Q6zLS7gq*oU)Xj)4UHIuOt8#v3%G9OgVIN1CN5DR`a*hn4WcMhgXDB zET3mhL~RFhA}g0OW>3rX=Z(1R8A>B*u+jHze?P<-rw@NK&kIl&y4o0 z%LA25?zFbbb0q!k(@9RF=!8@GnzM3FN?D7!<#~RA`YxsQ0HN@LgA74Kd!kPf;JS7( z{bOMTc9-*QcbLo2OA#@Kh`ezN@SyqA0S*o(*?$tUfu^W(7FFBZ2>=wKiV0x*H62-`5Fclu*L zA~Ipi-Mq2=6WV6m{YiUEZ;SypCJhiu0!L}LK>g?tkyI=$n*VCQQ_2pQKnKvZ`dcf( zW!^7Wh9_W1bPC5%$)`mLLn%YIqI6mGFsa$VK&*8n>!rELxi1ZUF(i)7X}Hj`zyj*c{HII61u=Y<{rl8{jrhqkAEU5q=%DQdXOIh0xDvYHV8Foh+13dBI$3Yd4~3b%RKPN&QF6obt$IcIBy*HauFFq|vp$<%f`KJ5a8XFyi<8}qXRuV}*ahZQ{g zB#I4Eenr^N1*2yg6?F<4vjkE^Y?n-RvKCWFXJJauev8uSfw0=yUMsh4+Z)tnp0TtN zhyM5PYvE0}LBHz<(y1Rt%#K}6GXFh~JA5SnU z(4kC|If7CaB`fZtoKX}kjSw>H4J{xGWQ8v&vsvc129b3({jj$U9dAK)8^_krX6J!# zIxW_rTP7Mp)wT=zd62oUF0=NxDXnf+`wUUv71&SpDi__ySdKB&|8%(&Ba<$!0N(do?Y0_U~$B}&=QlWP~%Hr~FH$qctY?fm)58_koMPp*h( zJn3j+J$KN@k#?RE6iF6U1l#d{Cx%pb1cTHP~un?rQDjRQ5zSi@)HkbH|YsJFE} z%IdEucy<51w_zb#xgMV1E)d6-W~&UlNK=dTyp9)j12D5bqpWdPHZl%RmduPR=4A;e0bB0cAG9A(?*V0)a!t%S*Pumi8vLLfTp)urZ-phYc`kn znQgB;!M50G<(_T&5zyFZTCoXVP2ukAo;;Y=wPf?8DSysHM5M?H_ zM?Wme+|<<6)Qt}@hB3?{hFEjUbOat=K2*|1U#4c`%Hy{-#+zE$7d#W!Jx0&BJ4!lA zfa!-QG4}*ZK9e$>O|?5TBlv}c?B5%;0m^F+?`B+!rxzE*;;)*`YcRhV4_Pc=nV4M|q$8`7S9o({=o;ipR}!KWvPa>3ogeEH1k6m9Ibd z*&c6fMz6k4v9uNlNMFG7E4_Rd&GH2dKT9!=t9!6PxVA|wDCi6ghLEN0zV&88OHD1q zXW-+DVY*u(O|nr_*!s|ws&Z<�ev`Q}H7y#R1zKkC5n?0_OP7^FqWWeXhX0t0pNK z(bt$TL*ehNPtM(;VA@5R9zN!e8~K<~cX3NnUF1p*`5e(DU1F8lRX-)8KbL`E|L`3V zNx2$Zf1S7Do%}yd%DH81m#>ET4sG1bNkca-B!p$@$27Ju`3?2uL@BKov2V<7mu!_y zZ{zyp_2QITSG-eP=P-{N#gu#(3@bdT4+KZJNda3|h8Nf=HS=!63yn&_8xd=3Jkhf$ z!}BGTsS9Rf-o-Z?Q?|cG3CC|q^rGJn>M0i8LCYqr+E3?cMnhr-$;c_-;y3nImk_jg z*SB>)9>F^Z*<}?lDtFvDC)3w(;J|^ymifdvBjSktDB*-0?<&&u_8~@@7`@G>U0<++ z9+SbA7tkuQpQRryewLjRBRYX|j#Qk}?Z|6*YO7K~og$D#s)y)BWmu8L?D||OjOHli z(rd40>4_~TSlT+@@R3Vwl4m533X}aO_w!RFZu2~QpnL7?*4I%LpD*2+wLVo|@%I8{ zzZ*2>_N_CqtE}T$qqCAa_KGgmtQr5qR1iS0X_i)@emeG`q0wmFbyr~nZu(wbqnm8n zm>_weO@nuHR=8~I#88`0`PS5U9d(wcUZTt7AX?2|`@=qRC83w>Mlt@JqGP!z*B~9k zLWkYhn<%5xrfan)FuTkCh{hk_05N^8n#jP+e{_`}<+~B3W?CiNuAua}a_MTdYyUEu zusJz*oM-`=N*{Piw?l43yLb=$GNYte%b+5I@-V7dC>B1^m zR*$`EP?Yr|V3rCL9eeM`ru`w7D!cmZMv3U8-`dIMVpnov@J7;{b@x9^3m-Z3Y{Z&* zD_zX0=I>)SdOkw+&z36W$kA!;9RD64IRcJ9N)qO^ytsAe+9S#M%>(p0L@&TU7Z<6d zXj3LQe0J3d7TseiYm0wOit-x`{PWm{J|RZs<&$+&Hgo2h z5yoyB+HQt44OJ{z%<^Nov&O3L_s`N7xT*-x6tM{ij1IE&RK^F;>C|9s3ZaVQ%s1ZD z&nS+C*X#c67*TD{>-$e&9F_U?(pP^n73=qY;t~6n@8+=ca8aLp%dr}3!iDJCk?<^K z&vypzO3_=}Gj~EnkD5>38d&H~S$*Q#8lks$jjwQi7#*)n;Y=>q4V;``tYFUD_J8e# zh|!nSX8$YmI;3~P|A88khWk?zH-)?If|Hk_xY3dxFKoZ2t zJhyn*p%TVmg-uCC^US3grB{BCe;gjJc~y-@ArHqhvcIIv>?>x{3Ka?IQMYkLr(_(> zW9Yhih|wXG9m5&4$o+&R?gWb^T_Edb8q`Plm^+Gd%I_1>MvGg_x>l(|hG zXL8v{RZZI(QAKaWHr5s{+1W7^G~V*hY!i97m?+bvfBkF?1U{OvO;CKD`v$kh#Mp6S zW}dnS&g=07uy2cfao?kBg`l52EM{x5^{qZ9WVy(?lQ9ObhGymV&M6W5@vZoDNTGn5;{NXx zX<|J~8H=}B&gYFdI$k|n(j)EUEB-F--tzpx?lX!kjav~2haKue-^}@3(<2`l9v*%V zpct`r=&rGCgdyq>V-|xIQ&eFazpBmQxvNAkeJ+~rNaF6(0Q}arT=aY7^=HiHH|9($ z2FqKi7a4zW5&2$7`1++}teA$yJok{Vzq)`Pmy%Nml3Kg-F zXgU?f+Q^T}S6DR=!9a6CFTM63I1qE;!8>bUFzl|a`*)PGkDYY|aNoPCe2S{MV#&TC z!F=~d-rdNg6D;BHXbe@$z9Ddm+VuDVjk-}hr>I}r58#I@|Hf&`?C6on@5rDQ;BtN* zCm#GK9DZNG)n!xr>vw+e68-Re^a17vyB)GrmOgb32YfBAX7Z}B^qsjdl3ZJRYm~<- zu>14DocgGES;E)15;iXQOAcTgE-RVS%WN{_ViKsrj|B?;TuuS3;|dS!u*jwlru ztBk1E6!us{JY>%V92A6y^0s)NzF5~my5ZE6)b0sJz-@?W8pFoHx$16HHPOny-p6#g{Jl;f&|&AJU;;%xQ`;X{=fW1tN4U72f4 zG2cMw-+5+3LoqX^{p5EUUI>9<26SbY{c>rF%o(YY8`tmLVq6s@K1cKBOl@2}*jRT~ zwnF^kOUr9N0z8a!ueni;qm=x6K}x5od!>a{9A3?Y6I!_mV$%j)A(Y*B&e?@v8S-a( zSs!W+gCwB|RuzEbEPOpaAT+ZfMs4{P_i7&;wmSDNBc#h04lydP z5hC|$bEW#=|eu-u>CWszC&qFp66I!fh(Y*Z8a;X4HJEb(E8rIV;uNI`YuH-0LG z_x|L@M;I=omg$aE(ovAcYk2X;oS)P(zTYR)WiNgO zyKe)d4l{1;mgU^sK2|@v0DmngV>`~z-{GLowF<(4%{)|B5!HIprtr|JB(XfNq)F41 zdBg7zqyK>m2|zW_rj-*ODz_K43Ai6K?;X2D^odN@Trxj!?`>nAs;1XPoBi~&g)}9R z%Mk9FZFTg7bZi1w?Ot=Hz}>6#t^$S6^%~71Rd%7%yXx;S_t zt$ev7PH)oT_RV1JM{E6CffG#%%Bw8`QG6>kQr&(jVIfv&iAif$%O5ydUwiap6W<&v z6Fcmpmhs~C*}t_NH&TIG85T<+5v{-jE2d1K8R0F3_wzj=JtlSsiU1_P;jIu^rVt_$ z12*~{@dWX^EGlooFiB*1lh^f3mtR~?6WXJ5B!8FTMy%2r1aV71x1-&JDdv*D$fk(E zVm%|}?A;~_a#xV!!8snvf{hP7d)bjzB}+edZ+|(zqRkJa54CYhAB$vW9i)=5Jb1Td zsKHz4h5CdIc?r6d&$A<`fhL|44`p0}NYs9xL{5hW#nr+3gyFT9ae7LB7N1huo;yjb z&wqUL-Jo$kkm45a9E#{1v?(hCYS$&-Bp%v6bD5a*gN`dT>3kVm>-w&YhaNy*!&?ij985sS&kCNa*JE8-5_j zl*)Ynf_EvK>~Nl0&OdOB-Lk>%-s?G}==9cy*Z4c0bLjG)or+@Iy6*0Mt>7%jftcqU z_udxaRbCWFgPc{vTfq-3ZDye=9>R0)Bi@CaU_mpj1{f~K9QZafW~F|U&y<^Q)&CHq zFo4D-zr(JPUg2U$d;*Q;!ZuHD4D6}d<7)|w^W(gcEkIi(h^Cp!=CPKa!I7uay&pJ8vY}rHdBkJ~S=vi+eT$}~wv;e%L7}&a*03xDe z641-lqNOI{=)U4uT~qf@4QM{Q=j=M%-eZ{#(dJS=iu^w{4uPI2(A91YbOkq5dnMu^ z15m)6Dz4IgZaQj_0FM0W-{F6{QB$+Ehc;Vmu4mC%2G{h-{o+HBkP?7|AROl^&*XlN zc{98Ncz*GL$dj#;uK8Yn9=-%52mw7idF*<#&aI$(UQuEe&OGOBRZcJaVH|)#IH90w zbu(d01*q~5_r>ReULX$yb~x$fg?8DnBhL)Ur!y5BcXn#3)B#SIPF@jTO#X+%}kW$rp4 z3HUieI@rAoBzq4wsev^5inv}1Sydf6MvtALXt@YrrxxtnRhJqC@h{PQq)%?!|2&PT zpP5>5)3pHS*KMqIO&W(WVY_EfVp{Cxd02)`XoJK9h!XVb@0(q4F2# zJ}mNy&+|Bnmlqv1P4hM{I*^EWBi?`d-6?cN$lB^``8zBA%$r;9tA!NF3I$fVIxVhD(!OdjKfxSyz0@J8@s*BK_WI$@|uGw$m!mVLT+5xsx z{KGk7{QTE}Jx58gK}JV44rH?!|6Sc8AJ)Wgapd0HBQ)FW>n>WJ;vmc9Ex!(h$pqqc z8QU$FAE6>prrggQ0J;1iHDkRVI|CX7z+Xi`kvVmn`a8x4e!nt|yE*#)L1tRH72FwP zy}zc8@yNOTAu%*!f}4v0+e|0--z5ooD6v-%V({(K1kI(3Hm*lpE4|pVS;4rleR&L?aN7Kv{&uC*`91Y|dCsl=N?)>V1R&soy^VyDmb4<38D)!4InyyH&6 z0f16w;%OKKXPivp?+|A&o!mWFCBUZO|8%zX^pC0=yn*wtvWC$=-ao&Z+91td6AYAd z!l-jeHRp2*41eHtPKGkGu>*&tXe0PnR3d5W%~sw)$Ql@8vJhADJi-kl%mUo*d9lT8 zdO|NQ3VcSJDtZcmSOat* zd%gvZvK$-FccrVC9p44n&2AF*>TduE);a!3ZvJ$2;kOrUzvKx9m&SqQ!UN^W&SlX+ z_Hcl^&Kr0c z2vJj0bsAlsEv3mQa4tNe+GnM*KG3D{Q6u-#U4aBKIj{YuYvU4kcx;N)(KzJ_={MjAFuLS?R3PHnijg*CMuZ5>*2TkknWmFH2nAKDBSVjNthgj z441SWzajgc%#wb9c|*XjDC@+^q1o~Vlsx-%@yuDGtMxmaxH4MIRjAOva6YW< zFzABA!sNW}3mFRe+N-*g+!j?W@*&}0ItKAZ)+U!^?=F6e$Ue;R>Y}Z+=M``$sRg*X z9$@rO*o*(H{6N!|M=q5ABL$mP{Yh>C$9-$4KFZ$y)1!4et}IvZ0*zuhK_@)7;<(0tx5Cm_Jqrzhea(H>C6xM|;cjg@1w zuhx7IF^WgVevuFJ96L?gU2apvTk)CZr*?qQ0T>mo@y@AFigJ|DC6+=ZF1>);wJ#Cu zDa?V5@}Slt@1I~fKZ#UZR_hF6Yx$E1Q;krj-qL{*Dcz1rXXlpGW8$14M)cyxf&+86 zb*Tj>$~LRK_QxFY6Hb~b5oSkV5zY@{Jq_yE{tzZJQm%6JAS#yb&kA8{GXB0jbBM@+ zZ-sfD+rX?hr|H;u2ge6bu>%Jfg6}b_?6b%wEAyYV2h7wQtU*A5!NroL-j;1`xMFXl zSIF@ao{GJz(ymN%m&LQ_-=mTq*Y&xolD`)q0IyOuhKmz0DmK-x?U?ez%3%;&B#Y{S zcKR?(;6!&T+oz`g-5p!NRnzvJ6bzS72tE*=SBRT1B(eV_cWQj_)tsbu+pee*w$Jyt zRxwb!*;1R4{axORv&G?Db8yEHS>c3Nrx=?IqPE^|29fmMJMR9n$Ws#wzY1@%hl{Me zuGwB}y&sGyjixIdegma38z|1h&!9G$bc@^0?E2B9rCdj+sHEFr^(c06LKYQpZMio= z76r-X?~#%*%On(P#i*>Itgrc}#_nA)Z+(Sb|M3cE_KU1Bq~yw?3QE%!Ve8I z9KS)gws75Rc>?g|TG-=@N6W~{#?UmcP!q$slAzUy+*sozSkNX+A83(}7TO4(!uk=9 z6Va5j?R6NedEbwrGJ0r_1||=l28w=M_x-k9VG9n6&^?A#^Z4V4!Jvb%UYl;`opV4| z;Z1V^!i5d;YOIR%0~g^wrmm@n+sVsiG`f6x8kvy1M}m&KHhD$QV>bF&@P?OfaBbW* zxC}sWl=Du-BRX~mTduC%3r-Ub)*q5Be2=qg>HmW=_D4LO-pQbvta6x_UG5C>KBJ-hc}&vz zZ?nwzsH)wou7?;C7=js7Y?7NI*=tx=u?=#zFkCg+SJMYG01Dn zo%MX{qLuA=X@pPb$z?@^;@3Ope7MJ1t2@9nbhOCgCt?bRQ_wPD-e}3QosK=x7I`@6u*Y&)f*YmpW*O8rQDj_T- z@}h93a%r@n4-iJLCjaHc3#jMD1SXhc+xbu3*;h{e`x*=6qom#zvWJ(#VRL)Mwh5FD zA0d`5DcpW``T@6y6l!V5ZR^l;J}ey_*!gm4(E^kZCR_v6K-n{-9Et|1+Lt*&ziqBQ$XXl>)uE;ekq^JE{zl2xhx>V^#t*KS+K zP0(&@ExRQ?$zXr$n%Dj#=U@Uz?nRyL=HXx`y4PR$SGem;yYr-~-?)EOog~+FoJ9S! z^}+KTC^n_Om%rQps2kVDz7Uj}>*sq300^hGGECx5S4OgZFRLSaA!}pE*q3yI3#(9Rwg zftY|o_2f243lz7s_IJkF&Y(}!ocZ|lN`{4U@K+-xfF@Axau+YY$CebSMlT85x3iTz6X+C|GlUiRiaRrN50`ZGJoy6g(1VHJP#d@Y%C0_2v zeYdcGU4|6zDE%cm!D{w4ai~PwHdO55>o4ybp>NxXRH^@{QnUNOWCB8!qO7Z$VqlOW zNasf1dlf(7u?<}0-|N+PPrsxK%R}dMt#wXIJ?7yJFwIe&*6ct5cq>Lx?JcV_@!1{5 zxQbJ)?BL5ZN@}2fTBX#POz(p`#V@-&1#e4weCz*<|E{ISg{KUPtp!_k}9@K1@mB7?>dG`_Z5$0R*ozIiaia!mt8GUhq z$~EQA9U*yf>BGuLPvX+Nw}Pz%q-T)V;^sF5ss~VD zy(CckI%aWcUnxOK?KOdRL_cF%NM6DF>OnbFKnx7&sH1Oa-U2g%&U+c!W{%+fc|@ZG zC4(%NFXpT@8&G^Sczd)3|3bNxP89@WTy0DehHRe*kQdMvQ_?#%_3v1zbOlB&+#4n^Bg7TZuyFk@ec%HdtcvOyuuyy_98 z1PLHr`$^>|ztey~!)%SAfT}ZiL3!FB2_vRVRpq1)N5sK|07RG#oIm)D_~ze2iXy3G=N#aGe$H}bppmCMKC15urD zBYDNQzvwY8e425y&2uCm)}6k=6p`>XSWXF~5a^BTO{bq#+6H+A{qeP@6X&}5nAUNN zu#wG1-AjyIyfBOrU-5N3DVgPM z3?=KCa-{Ojnx35U%-EKTxru8&E)k9df36s%fJ!BD+8tlXH;z1b(E6P8j_&lu1UG#3 ziZ8MVA<1mE}kilZE7d-S>a7_8p1orxsQgIJ+HwbBgyuar`a415jpG?foKE=+Qi zH>gOEyM)rngbbfAs~q2F`i1cmdLq)-MqBZ%tTP;?n==}492R#!+*R%jtSj!lOF9w2 zc4kh5HvcqN0Stt3%=2$3O1;sIOWl7K7v-z*1_DR`k4D~9+SBRYjmHZK)JkY*{l&gF zghnKz|6Y#^4qHzZl5Zzv@i{V&%lH{rgsg{nRRMju4Jq}g9vostXa33?lm!U5zCHOo z&cJS+b>H$hWH@>g>YV=g7?GF@ogKeFu0s`Zt~pibL;h%{eQl?}S8J#7HJix_NC^gz zh6GiYtN(!a`*wesFswSDd9&X1Gru=7&HAXRgqd>P$-TWrd_{zh>c>jmOHMD@DY0cY z)O0(8iAw+`u6?|trmC#XT)~0 zqwlp9+cAU$BJC2qb>>T1FQflL6m)rc9u{Mli6NR{^ap(cWgKTpfFc=!WSsg2v~0L8 zi^j_z1#;p=lss3d2tl(sOU;h=K|{vWk=Iycyv^Bs8&VrTM_;t*QGVc2#r)#}RwssE zi!PocnX4lDe;U56iSUWna@tQaj<$co+iO2N=*daUEbNQX=wYq4ga)f>ETQ1O10w} z8$$isCm3D;Kx~$^!0e{l=ZMk*FmFOi^}rucr?(R@7PLJvx@5!maM};SWbp2*(G{UC zxGvTTSP%>q%k~L)+uldo*MzpAy3^^vVl|1Zi~eh``Z_$W1~2#!7afz|c9p3!wdVwr z0HncX!lya*7wIA4Y0j!j#hZ9`wQu)ZQ8BpmH|Raw{9>unZ`((JOkwc;xrNo(Y^r)v z5EMJob?M@XiSsYrw;ZMW8@Lt3JjFhwmDzcIi2bSl;P4WM(i;0@%aEfe72l|3l*g3t zXaWcGr22~jgPPJ1yVEw%Nik-GWC}egHFHN{c5)tBPc^j*)935%%%7D(Jpu1M87GB` z&I$uYmhLO;gA6yCiOeHf^O*7o#%OK! z&qg`>1%9l^TZA1Ee2OBqU7ZSj!5J_01=AJy>agDL+(OK9-}Qd zDy*aLP4MgZ-Rz3YweCfbCSeql3lES(5cYCWckWFWzhGVoqYwS~BK~bQqs!eW5CM8(&Zj zxg=~lFlwE+$wJi8MzmJb=NYb@P4jInnsIGy<4OJ2*xusTj*}|em|{l)$zXzM%O3BA zZ%w^~0q(8Hy0g1X8!kBKPwI(0zIdSh5T#3Y@pGOYS$ed!9@)kB6}eKyI2NO?NGUo7 z!WtM#kV?j@{c8b-;aIZc?g>7~@PhOlPO5q783-N(xeNAs!OdcE;tu}e=tLDg-UBk{ zI5@Qg(P}d12!m$+8oiyKcmk=tJ2>)v_lPLHwby+gCc03JQ;WM-dF*e*x0zrQ6S{Ze zo9p8-bi!*mfVdfN_=c3IAG%+IwC|3idF|u)M%Tux{a75CME{NOZTx&`<7+!`Ea>j2!4}ZP zlt%a*35=!pk0h@>r?=2<*^r{@8OsMv=?PcwSEyA1gy`*fIf>DBB*V{-iX9 zPg!-H-RnV30eQQ97F^viW#E}A)xyx0F7ELxiybA;iq$`UXD+sF>kZW6FYOnG_ zfWim=M^6?Xp_ca8Q)x`&+m&l?e|VP7b~P}*5QtMhss3|lhRPsV_uX5-mG&q<_ak5V zOzV=Jy~O0GH@#s77@x`2m9A1i`S4gY<;dM;Vd4vrsa{DsCC;RF7nXUl+qpUTkb)*7 zKTdq-Qt(#6!uV-!jLr{d62?4(m8O|+E4B#p3qudh6;#Z6G*`>rz2C<+jyK<5^b@NY ztzr1ZzUcyx?Bly>%HWB*Z806YB~q2&HZ9t2Nf#ipwV~trE!Uyw>ZmUa>$BUWI#Mz- z`h^t*u}-8Y!iY(CZ;uPk|ZX(5ZB^t`IQfO-e)uXQ+0C|ztXd8hYu=Z z{bXBWYX|#Z#$E`Z;`a)tSqM!Z-aMoUdxLu!fZuQv}SUI!Pyc%^@K!ES@c~@-~fT&+GK3MR#{`ZMxJe za0)Iq6gxFz+gB9M+au=-MMfLA-)y+lTTM5xv+Pb_+pW8tIja1(7X8F?Rl8CBk8}?v z!^+z$$zE`o+3LuM$v;aoY}R)7l8(fK*Wql_sLA9+;mP zGgs;m|9DZLqWXh9Xtpx(;Z$xE24y~}WmeH%6-5{16sZ|x>M2Igwl?%lrZz0k;69Gd zgr1_kl+wuPHh!e^(oILs{h?AvpGME6Crkyyk z?O7B0&V4b;FxRE3a_M(lhFBP#@RtB1MVA-1#r=$okm)#NX=8I^iBR(n&uj zIhw_cxr9?@#db`v?h#shxK8?lC#~9*Lj1@%p+D1rN2Pji-+#hAhivOqtI4_k(@+QK zRw>iV#zU7}Sab~WQZc2f?G`>IfGiupBzSlBK0cvwDyu|3gKUfGE#k^Amr4!)5#VuR}%HzxIn)&=tSj*{!GC77J9w%G1?x9}J`2UhRs3 z0{zJ|?BbM9JAMP|rF(vMJ$|ezguidRfa>$S3D$1aG^$fYHGOp;%#*G8PT9Gj>5!fJ zD3`@8ok*3LOO{dQ$jNxzOTp36l>D{iClB{p{G0CApGahSTFE~#j$sfU>^Br{uZ$_qsv*vtZZJxC+_{ zsS34kSPtmFKEyNJ6b5k)N#^CL4*_QO(lcl>HwNLUjTR2!qXh{%THEjLc z^?^I+M5_8}#rZEoeLL}Q$xL#Kx=_m`F2mu+u%@sds72m;mknKDg>nk@o6LpH39nUHP!sCv1Tu_@k z%dD)njLcUtIgNdvve}Tt~%S~&z2ldUoj2ACMql5qgn#V{O zKXdZ_lYJ4mzhZhrxX-;zy+3AGw4s@o{8bshtC*ESA$&x5zyG5vDsbj_?$-Ldd}hN3 zCO!oj+nl~*uX4jTfoMvOBRT^1Ahen@@2a=C>SU1fD0{KF*%YyLul(?Dxq!AYikI5A zQ!2rLJC>W)p0BouFKcF<#`0_PeBn@d0&gDwVjA08xW9<><3lzvE4PWqDg|_<{TkZ2+u8gD!dVu7akbNQ+2itVA%5pH;ocR5OtTz5bYBo# zRuEoLTbZS?ch?$Wr=Xn6Ubka3tJLqyp|dX)p8BHfd`16My1}L`WDgPJ-}tEpkp`e~ z2hdTtq~OQ_m9*A!&#H;@@RA_YaC+Bxp4<5K;m3$4;7?zv(pS0^m#<=D_&JxLl1JmE z5YapS=RFUH@u(D!M0ZaQ(dV=UPAu=M zS+a5Wmt}}dl>RAwC+X>iR54RfNn7YbjZb1KFK?V^rwxcV5%UCm;qi|lcQHV5`eIIdyWcuEX|NxMzk5b@IgYakiJr5bGBPu%dt zm6r}GPa1#|BDe&k*mvZosws42DrK! zM*BJzH!Z3klBOQL+SFK8C3jo%LECDTyT8hw$LhvNSfo(|>n;r$yMp9cuiNAwWY{aP zg1zOJtJtOS@zcUfn|y-#W@c`~T8Dl=hf!06=s+#a2VA-jahL30C)zbq$1D+p98~8$ zOFIQ=q9g{0|L!=v{0NRqqjWE@@d-uOsa=#%Q?(zB#`bLByKESn@fVVxhAPQ-{R^9N zTkpF`spJBg`E~qFg>GelrqYop4+ZI{O{d%^5mB}C-x>X9MNp_W=6Tb0uj7BVv+mKP zT(PNV5UgO>Gm_~^!*QH@yo;v zYfIyaWv?o8cuUW5a(H+d=bq))%*NqlEF!f2u)&#Zs`L_?Jc9#C_^RU7ZIz=H#}e)9 zAh|`6Q7NE$QQPdI1$5R4K0b|0A|Le0I$nMg+Xc^}Ym!noE!UMhVD)lV>sbq3C2t?0 z7F+i1F0mPUJbJKct}?VL9EfON&Yrm0YZe$X`qa%|#XN?Jp)wbTTO)5!n6Cxw^kjd# z95jO&3!cPYv?och%QqXD&!(Dxu(`S>V7zp(#xVQ?&e+VsUy)gRlMn<*oopnn=N-^H zdXV3JceP;snrVB1a)Qt?sUY{E#Z%YMN?YZ4zryE(T@xB|abb|$d>5LY#izmucSwlf zmf=C{!Z;?5PlfkSD%)O}>1Vz0`SX1J-h;8baggmI1D zq`*{VlbB})JHOqW#`Xs?;6T^Dv7UZ;qs|Vm1J8;b6t;l}<#eAQ3mJw2@&w!}xu^-l zfdnHa|6NR=o@K^&+ezhM`U7NO?A>N3_U+H}lPOISlUs33QkYdTe?D~v7LHWv z@=%qjy%giJ+V^Vx=2GBfuvQ&9)(n|*Er;oY;h_}~YNQ!xj_UhH_+h%!$WElU90_nx zp6?^|HgWnjHyd0$<7XMaUGvLfkdeM}`;Jre_ z@RwC~HT%CYEP|^IEq(U1eP3F%FsAWXx;Oi6G*=s2#Okfg;v2M8krrMe1z{fk!2NIX zrGLM=m!-UQ-kT8$vd6(h_+npscuAb;-6tp?Z|*P9Z3z!m=GZ&T^5F@O2i&LiZ6v@C z?LqHk+|M)0!#|On;lp%k<*oYbaoI)9S)!^9O0DKzqV?Jl6>1}N3F_0sr=3?{r%OUU9P-p z(lgc*X?xv^CS5WB@I`Z)+Acqlb?N?LG;>?ls>7bWzMOBC=$Lo_)#a)~{xAR^(5SU^UdBP%kEhDthlQ&|rJ$UP)WyN|L zhBc?|7@4Nz%?^c^jyVZaEI1v#Y12T6P*LT1=uL{fU#7LJ_fJ)|bKx)w(P8b5AUOc`~cnUA*?OAp5iI=;!P&v|g~g3Vf(dNKn@=jdpn%yZ@47a9djS?dEsJp~c;$T?w~}V8bCa=8ww>T@D-g zm;8zoo`&^b#)qU-a%cSSnD?Gu2%Q1!Xijrhng6O7CjSk|c`sbX-JO-oTHjZZ_4Iif zq%qv+sJ8EMo84ED^OXwMaA#_kSq>doD2w~7X&dYeLn9RL*DHMHKr46D?YT|hFo{9GSbOCU$c_3fl#;h6Wu{k)LaQ(;qusA>QMOvLn zKhdRc*#?wz;l?6cV)nviBFOV@`@FRV-K!pX>bO-!suumoC;q|9pdrM+U3N|-r#1Mv zxjN9Wn2r02k3v+&!nl~=a!sinq502tOKDHuMsgZSNyWWv5dl5Hi z6{pspRvk(Hqv|!ub*F>fCkNUY3+h+g%*;2m#PZn;#|4&~#U}H(p-g8mHbzbVu*K%} zCDm8N*$lvppuzf~2y{Ma#2F3>Kei z<}Yg!u9u4MG+}VpB5f|HS{RS0NsT7zMv-a8-=8REJwqGzmQSIcvG%rf`oXhyZlx19 zQ_s+Ld9bnUO^jN4KENvf8qj_U3oXG%;-k{9_lHljgQ06jD`=;rHdBt5En``I0q!)P zbxHgGJx2+klL=IKN~mxduQxF1Dbrky6GeSqw2Z_* z_aM~>A3V7cz1$mIJ~%pQ$ye9F$n9~op`Lc`+a_F=y4|>vIaqNDq@=tGTF<%lLKzd@ z`}oo#@oW3vk1aMzk`+{C!+4p@`&mj9{QeJ}BY0t{CK8q)5Pg^~p1<{hj3G`<852Pl zep*mk{YT&~d$Z7vBfHY1e=vXJh%j$fcTza-=3lH+so$$y*wUPvzqz=8>?cFs z<*U2QLFbF3a;}KIEcqJi;daXABYrZU^q=QS{KE&R`C&eN$q$>F?7_9?GMT7k z-V>?Cb>OX6EbTV=sGJ}?qSs>5unV(Ry-z-Xb?#%o^J-_wDPcW-Prp3iCE1#EE~ll+ zH5_}C<50trknp<#wUCyr56<)Tz>PdJw#OsZqEh!wP}I34Q2UwK&Nv4(6>fxSz3Sn;E80Tt;Hm>z|-y9W`7JoXh5Si9Q<>3-Fj0SGl-0GQq6&CLhNvxW- z=ih95pjG-+B@Ry=s38Spyie05ONXv@FOiwf^vu^QE62I*B|f(iXlhT-yj0zfmoj

)bNtXB<>| z?zw$VG?;}cA_WMLuWxkpU`bqq^-gI`l!vzyJIgmqm5DEFjm;@^zl*oW_s|8wm8e*b zz0XFbT9w}8+|d^`xK_6-vkAYgt=Keh)4pg{f8qatTnp1$c}kL8Q8Mn_uNQo(tIlKi zpX6ZQc^`-|an(4vp*vd)^SNh=Ro#iKRpvBh@*kGgjw6S?q%KHqoeH6(_1wIA`lV^z zAiRs`A3r0$<3C?@`aE7#*py0h!ZV&RT$9)V_a4o83@+F_%Eo_IXpu`p#0RmnkYKV6>PRTk%i$*vH0e2KA$-EIE^&JXaojXAE*53ZKr9x)`Qum z7UB9BUT@5(waVq@friz=*QwcTSIWnOG4BIs|6G-zA;m{oOAc}4!>le3X(;(rUNgef z(7*5!tt5aZn8P0!173!kFHC$!crh8;jTxMQSIE;}csC5F6Vx;H$&(nH3E%(&HAh^MAf}e0nfSMQPOniL_ z7j57+Bi!(wmiNfn2t9a|2C1x>?Ls7;Mf~#%uyxQ4XbR0iiZG~93)7HJPQ|COV0;>D z#;*;}%i>vM=bScHgBHF=!NCGns4A2;tr8_sKh_4a@ zt{B5ZWXgYDXOdJtuC%DBe?Lald9&;{9%iclNek+#CCvfe_-`5NJW@!FZA`&&O&=p9 zUwlVLYHm&ldOFGYwv^64tn!6!H32EqrT>2?b9bz=kKq{R5PdaZBW0#`LK1sQ18{uJjq4Q*}wb*uTa%(>{4%;VK01*KSq zh^qcE(^@tu>pk>REghc5E4ZPCWk%EaO%C z&%%0tbPv5YmqdT&R)}mL3i4XV6jvmR@TXK!7qX{ZJj;Gln!(~06Vc5%7Z>XGw*|CW z{3(&T7JDu_+<_&!Qbi0h)Zwm?Xj;_}Cbifn__LJbIWH-7#rR}P@spEbTfxO^XYW%M zhJEnJEAHE}H`p5>4E?|@|MY1)YOBU;fR@a2X-nTo)!{n3Xe8yyJAvAW=7UAr+^*hFU0;)||N9fTIy zB@~>=9fZueR+b%uo2$%=%7YAE@|9h4K3Gnr3xsLX&S#8Hmt95P4}F2SFI?k!cZE44 z^2&Ay?B%9a<(R{>NER!X`!cultn!S|gQPK!EeGM-a%y_zD!WSZ*gKbs4pw(8pY<-^ zZBJZw0{4iaQ9^ zT8kD}ql$!cJZi)g!$|5ll7vYeP!8VLd+Mk=2qkg8GX(MjA-$f&*W^R5TcrikeH_3g z2RzjTDrfB$SYPI)M3L--)_uH^7i!obxP{DPi zM5t48>!<|&hzBc#kyj=3dbup07F$XBsm!&;-|?ih7;FeG61KWhHgd-0#CxaI2<~64 zohOXU9U8pb+TZb2+zY+0l&eo_^T46u{q~Ue|CxIAMORWHakreaG}#%Q%Wu`*Og7GV zU(<`Cn@pWKnelXBd)xB7O*ED&nM^4DsVG+&`L>C}E7;)|eoNuO5us;xlLaK?UPnWL z9oIsOax`n6NWdBgeD0uZkVvFNYZ%?+(*c2XdpL?3?WayfRx`iGtCGnq$3sx;Vx(au zeMO66%Z|@fLcKSiZ}rdp!ka9fSR9_AmJ&!TPG)LeAcVXh*qv(ZH>Fx_p?Z7S7nWz) z)ey*k3!|#s(e?>@K9M-NqOo)0su5>}F+r^NmaMFtnvw_?(x_3SS5a+IXoVT<|7f5n z-$buLmMlGF3C@o%cq8VqPK?AJsprrN^WyKE4no3s8pPF}Mx72q;$0I|xYfakYG_Gc z357U>Rwm+~cQ?0o5ZVLAvyHORs^qFRX=&JXjNyp<-C>)ib3q~29*v;gHnL2YMhrPvbt=vSuYW4(cr@f z8=UnNlqNf&edfv)#HSxS=HRS5$s<37`H)w=WnJZkdw)=f6Q~4HzGpHu=cCi6ALdP1 zOCr9WAv56gk*@9&ED&R5pq8^O508?s7~M)Fejy@&lnCqs11Ju?5*TNoMVw8rVifFj zD0Up1el31t94lNCfFJZE_M$Bg$??f}Y%#sOy>j30VgauF7cy3Jc`~NLc@mm zb8?LBF*sBh>XCT{wRV0tuIBgEOClz^!hqnpS-}56WzSQ*Z%VqH3wb{?>5ydo4tnPU zxyUu-egF3R#hbM+cj|mFzLvWi^Qho&TOYdh=><&`I1208d#|_`Ht* zfRdAjL*2={gxY5jye5M9Fzx%{!{{ykj`IBreyhrM>4S#a(B$UT4niMF_`CmYdt<}! zv8TF&?0Y&h^K-)qPt6Bqvdv`30^U!{lAW*_lN~5#lp;HEsikw`{me=8=mP$JDi?Wt zpa#P;VlYn}B(4JBW&+~lL7B{A@a#9uw?wkCvgxV=oB4M7kt}3Vvit@|LV5W!K?I|L z;3>H|#C-&2vSf0SPNeU_A;)l4Y=bTzbFMEopMuqayJ>Lz%MeuS)id4_(^6#Vsx^#o zqJb}O-d?j;t$TRbuU`6g@^K<|lER|I)?xgC5t-FXN4tI4sFc_8?ck z_s6pNjh^u1IPD}Zwz6z0QHJgOnmH*Tb6H$7o)*DF6c6r@K!6SodT)WI{mhGGYJ}Iv z!G7g_coQcvliHBmNaKOzCs7eL*ZUIhBH6^Vh1?Ut9Hgq~`^Uy{HQT9hx&FUXSiT-x%ApC;r_aezH z5*`hvJZYm4$ztvx)wS-`9#1_?{hdO*b6x)e;_Sl70nEZD-K&s5e7azHJS6&nIr0Jy z?hX=4@T`nG|L}!jp#>f|MKlg4`HoU`vDo%oI}t>JFDa7b*?2-Xjg7j)tL_sR)!fA4 z23JD&1o4a40%LCb>_Aj+KL-dDo6-q&IyRM3Vtl zU6Y4%0zY5B3a3h_CFR^*rw14cAhz554#zc6UOiEcHj1tR-a)J!uynF>Gtjm(L5vac zkXVJ}Py~5D=3bgQMWH~wV;yehqYQ&q*5boqKlP*5;s z`X$CJ`Am|30f|^+vYK=ms{$_?=mVJC$3(L1Ny~P_IR~dzTaL2&%qKA?v&>rSREbn1 zkzOFc&M>~dF3>-o5p){uFYMDUgU?T*?8t2ujbV>sTsYHiSGuKX-cIu3QDPS6oVyA4EfZW2Xu4$^yXXbD|MOyt_HljBV9W z6`249m?4$_7Z3xlgJsFO8%4&}bYl3;ZyYtwQ0-PxX`kA^+oQ_p*x74by-6~1385-` za4&r=N%(~UHR7s(Dk}VPdPzeDZiiDz89;xt4p`a7Tg6>H)D3wmCj|!yibe7T{AVh; z*4=`{Lh%R{UP?R~u#_Hh;B9SUj(aupz6921>-B58q3%Q7{#bHcIb^a=%!{q|0`7%`CQcJU~7Riz({dUF&@K;~-%)}AK|MpP z6Vq)quNDoPAyEd~Zbr-yWc;Z)i+Ff@&0EFP-0rD^+#qCOLB+7J0{)#VaJAHF?AKT} z(v`Yr>SbyflDqkG5@ggM7A>wpIw7u#q*V7aSJ^-QJIP#+3%@TSRBw}~2Sq{JXiSHN zCvYnL$RPDV$sdq;5H!BCyKVExK{i3sTToWE`yQkVVmeuft0<@iSmwbkZ&W0`8Hq}1 z8pY?Q4kVmBAl-6C3703W%N+{L$2-ptYO!Xr_!s~_mYIKk#TD0f#l(r)50*1O zT~}6fshz-2@bN`%=&ax6Q3Rtco!>Xw+yDk&7V_`#v@)#s*R1XPkO;Kw|0ka~6a zdfJPaG8moV6TDf9k{=LetjpsNUZc}^*~h?omwZo}fmCQuOonx^b(n-}IZ3?t4W_#PZ236ID--qTq5GeclbvmU%r!C#T|19f7bM={LI z<$K@Ay!9H!DU!u7g?@d<%}CWobKJz-j;*zV=OZy49x4J6K894zlL`2^25M^|_z#AL zXRIxR;0&gwh`h+Me|Am;a4OM@*YSZ%LB0eoh2dUNAF~gb%BmMX2lz)ubQF>z&k;|v zXuXMHT#4$qC6F(|-5iTQ5?njvOXssIn6VZBhjT-nLXa_9J10)*#OMc(E~FW4_y!tr zpyow~JQ9{b<=G(42t7}_U*5Jis{Ng*(?eYKObubVVF;gk1;H1)`_hAs*i5FhyV1qL zn_mH!s86VWez=1m?V;$Vt0F!bK8UlrJ+X$$yoR+V$RpVdzGVrSVUrMb0r)I=BJkO% z_;ZL~1d55oZ&JGEJ7*n_=(lfD$}1Lk%(0H%06I0>{Em<8P@p2|9wmtwi94%en3joo zs5BV`Jf6IO|8BL{_3tX)rCp({-nhh}lkUihBo@j<`rW%CNRvD3+-zQN=HxCtvKuP| zNIYrR(!Tx^zCmRB+hK=BhiGvJBknGgf?KLqy8EO(XPvTw#;&~3B2aSu>7@gR1*ApI z0LrjP!rn1=%VhYywzo8Vfkez_K2wE(bANl+7!(j-Sw4~|2#VgPke%2TlsM#>2O zLM}42U(mDn^%}D32eRO)0Fs^#4_|RAO#u$wk7Qv?pvUbXdt{J;J3n6>YPP3zAc%2| zPvr-S$1_O%i!FnFDWk38P|nv@7)5NtM)P?EpeFjkip85!G?Z>Kt`3TKiU>k@Ntcr2 z#P?Bns)Ks){v6ddC*TseBo`@*_fg`m*AQz7*N~vkU=p*%bz-r|l&0E^;EHG2hogJ7 zCu*dN>lLXcfPHZSc%61JbC4yDBXEzmnAxoc&$#U`**7>xwezv8^?kb+LEiUk*vCQ< z7L||Hhfe6z;xo~-EvoBw=Vec1^%8ZRv&%|J+Be~9bP{&_y^J(7RzC_{lIY+z4=tj@ z<}I-`VGYH;h+>$^M(_cWr_3@9AZT<{dA$!Xh+&&#MKY6opZk-mKsA(SpLEx<$y^Cn z4gkx||C00p3n8eH*|2aioZK-IBa-L-fWcVn}SELDwx)Jllb2CHe3m@i&x>cGr9Ixs~!M zOG^|wxxkH`PTJTw$Vx6q7Ax79yy+6I=BgXb-)k6Y82cgezic&j=wqQLOON1tK{+=X zpWj+L2-Kss&cf)H4VjJEQG?~4_z1!Cfu8!z!_~*+8S%dTn}^P&d(*_}T)uaQKEDMB z0M~w`LHBpvNQK~#Louu+Jzk=+1pSQ(JmX9iy~{1i%Eh*0F-nab-tJ2*b{NC1GBZkm z<5WTuPy?R>lK%5c)Rw5S8C1f%69VqqvsTC+|9xOtHLX(Gm(+n1R|+kgDIR!cZe^SRw}7d z;1&em1-gDV6g*@e4JNquZCras|!I3mmu2_8wnNe^b(RX!YgJmR@kpN_+ke zN`AvRg&|j zlt6_`N3vKGh+P?G>H$^=Hk26yRz|@`CzS8?a?UqmvhMU)n#Q*q&hVAJM7=7`g@9pe z89^<=G(sm_Xlz7mRswoTyYz60oQcfIC5`WJn*c#XDC%LR1XncX@lk5zthKr8aWR6g z*hz(MArpKerN|aCl=H|}N;ULiw!VkJdB6UT&f3!vDrVG_N30uZJ*3FGavst7@RE(% zQ3-P_&_?8bq2tAqnG~n{@01>-qa3GMUVkVib@76t>i+aY#M?422j6bHc9ILyvS*B> zQQ;hTorEx+5%Ejntqj?MpK@L-A>*grn3}Xmf~eL9A<3fu@V^M${v%Mb`npo{-kWab zY$g4;waJ-CY5_)}&t6?C)$H8ON*&Z{gA*WkD2AnI$WqGr+dDx4Jha4IECI7ORlX%xLkM2S>PMcfQAoTHXiHgre$Ng``C+UO#Tf z%h)nwFM(vfd1`y)$+e<9#vF(0WB#2seWeOrC8+#Sznrt;aTFq+VHge(W zrLULV-9kwxSkZvb=A>{4q$?@Los{c>y!(<4Z}}x7H_1eA)Vm2%hAVvAq&Gr=X3qss z%ZI$*`HOR832P|h_`UCt@YeCB?vDk`1ijIFpj0~S;5t0+y?on^xUzWvD01NIzw-6X zg!GOMi0ue9#H92NEiey6Cu+B^icR#ZYNp@eiUFO?Nfr7Ruph>k>z8L==o+C44y|SzJlM0I*>xbKB8ipr}PC$Vq1>q1lcQUVmYSy6QkL>A*e-!H* zE^(h_rDTROBbAFN7eq_a_1wd0CwYNzI#a@`n-!AuwhhFxQXr+>8N&+;k^;lb@8IM0MP++-^ot&?qrdT% z@mt^g{?3Z;HrZm^T9}sx)ecIrLxK@CD-D*|m9|IDBSIvWPqVHyJ{kM@xVB3677f>}YM!uoen+4Oz@ixxU4lLhmdnA5_Cq zn!eQCP6VBdu#5-q++!n15F&4}luzs{UuR55zOLgFrsna*>NC!J?Cp@C$r2nxuAoQ6_@4>i!6BY@q3nq~DerN>eBtm6*u#Q`uY>m(|fJDWc zpd*|pqn5K+7*%^nTL*KYS_V1t6%vq`ecJ&{84B}oF zCzG?le%RKJAo5Za*j|fNy}S>y9=!0XA^r$uwZD_MT)i18>}k80A($6~-0{+6T>DhH z))3w`G*u{EYE@%Bnl`c);H`-I_l(mxT>~H9CT$R>H^+UeV*&En!Rqu z{b+UcK~w&8PUYTj?1*4Qo4e_xVehcV!aJ`ri#6`$VfW$Z)xp#{#z~hsQAf`=ZCNL{JQMT4Pss0(=nZcMfFg6F79R(b&tT1 zA~R(|O243sb%AyG9^}`bKkgKq*>=nPf)x~SUzz6ij(RZ7+V`Tx0@d|mcE1L^^tM(30<+-Ybq|(J5AS4>HfrK@Y`q@59{K__?e~yDbZ00uR4!EC zK}u!5t72Q@REmf9ef}1&kj+`|1rPau?EPn0Q)$-*3EX%0-|hsmmVx&qzM>$l?X};g46_f*AC7-_w)V#j`z>YF^23Jwp?a^MvK2Z8HX)tWC zluh1iQBFC~>z!PsW%A^T=>8Jtwc8<${h1a8n^>8BU4?QPO6g@$K)hihgv_aslG3u?1$j|mG z$?B)>^`%K{z!w?tsB;sEDC2dbVW znSH-t|6xiO59u~EWc`4xh0H^I`|Zn!{tGse%WAK#C%6C~(3es4MI$Fq_3#Ky`Umz^ zi{ynDGKXxhudf{#YSrnz9{D_QbrIr9)z~`s_Mbm}Lk}wi%pHe5TD%EkeY$k`I@yW8 z>_)?rljU~Yp~>qj1AH|SW!Kj=A-wO%kWh@+WP1Ma?=ZvhMZx^*vQ93Lq&cL=zyQx0 z8^mR?%ZCec#|gw5XNTl?eWEcszOdB%T<6Dc z-)uYD_$+2n%dz}tW{hVGy|I6he;J}uy^>_prkdO*x0l#10D;Q!1fYLKff&4F_cqF| z3s)!LZ|}992=N7J4lm}$8PGPFjGZ;PiUSils~W?7wF+5tx^pY7oF~n8C-mEBI#Ez-Co|Tmhs_M$jZD! z^9to#u2VT0FGPPZ;*L z4YxhBdz~9AIvg-VGu}H47T<@Ym#((T*OdKyICw43Y4%~6YS6OpoII#Z`_ZC$b{u2A zYQjk*plUg!rsruuZl4#alvcG!$~cuR^H<0A{{{$N0AL_u;N|)E^Uqr4t_pz2P%T5L zwQX`&e`;OaCNxloq+G;Opn)y;sm)S+MjEj=m)3#yG0(?H?95_09TE9ZhYuu;bsX>; z43J!(O|n?}CWkrsRMdL>&$<1sofqcDvVE5r%Y1uR>lo_njJnEq*8UF!K6=0=^AOCI6u2}zDI2WtoLgi5!?3k*(`e6zq|oz;P|Q43u&+O7 zYJw@X$F80NZL!YOld@Y+**>C>b_py*7oG6d8rUMs_2yu?B040%Lizz{p=-;VV$HS^ zmops%LF zVxnHC@yF6llShub9u}PfurHOF!kYHGZH$zm&Aymm$*WaFf^9Kmt;(aOT(W}6Unr4# zNDUd0KMe&14rfTurZfh>()Q>2ITvCGr2aDL8470<0M1M;RlV44P54*7?T|4>E03=K z>GcPtjw53p${XxV2r2aYUdktT9V7qKzYH{G6vo9k3uV(@%3B4Nzy$7Z4zTe! z*m%Wkil6+9n3=j;lo(%u7>g7RdT5S|(M5+BFR`nfavyu&^@fl9^1uet*bYcTGFTx+ z#_?B8A8okhTxiti&y5r{DH9WTBOMbp{K?W0#0)RLKcYv+_5^AEXv8uz({o zM~CD{qwvUjrJ-z+;IDPY5gT2q;xnM-c6;$tX0pYO^Op7ti+svJV@=UP=;CJ(VALyq zW1>a;+WMw1Wu(JFs;RzWsS>QQn5gEkSu)5M&3(g7JNuiW^fT^n2BgEmB9|6#>iR#j z{X7Qa3M;lI_=})qj-gf(pL3VtA*S)o>o3G!if{8G3k|2x7ABtuY2jQRXG5)C9v0QA)af8fj)P#}g6M(e|kL4}NJ09V4n?!ag? z*!%loe+P-SEkN8Hhe`yt$UEapQecUxHRvhh3+C2#_~i{DjW6Yn5`KMTc!VT~8M`XL z{$do~Vs*2Z<@%hVTNHNH)LRSExa3@lpN#W9=Y#v_#cg#lsu`OLlEF+N(d0x$#<7U7 zEJQ@^I}ZknB3j#)QwnX)#<;T*@*GiNX>}WDfY)U;wc2EdY`AR$d3FeQxzUtu;HCDY@f|wTXp-?}*4J1y&hSFGeIl ztTUU$7pwp=!v$1{0}?qk)e0s%Ze`qi8b?Lhnh0lAaO88QFv-)?%;aD)jzHZFK2krI z!mt?9BGH3or7|OO*atBD5Qk8E`%y<62A77ccn3bSDsY?Mf1IDD?dL#R)T2PS2dk-9 z8HLebj)KF2L6(u;1s6gX#K$ESlWH(gZ2Q3&6<|k3&h7Tne=@tRd_i{LP~vabQFom~ zTh>#fFslY}l(!nH!c8VH2Ov!f3({j%uG5XkI)v@c z({Ge3U^m7jBWMB(BT;wsw5wM7Y4O&Y8uKo*EF^V3qLOZ)c6UAeT8h&71pcZq+h8AW zhel>Fyr=5-!NInagMt|7{Oy)H0`r5OS`HSE(tgaSh}d}LB<$mJqKq8Pi1hnf&_D2} zz!^(Pm~QCv=~?tNw`?{^zChc&7bv3E?dXsn_bTU9=e*N8G&rhtxYIP!%MT3I#q=Ao z`vu#691De5wt4a9j$b050$7%SwdQgD&x{+wSx8qdiMTJWQ&W@7p3@xWs_h)*F=^N{ zzd9@eW0_p5^+tM|^sHcHPin81kn?e8FSDMb70*0v{AcLg2Mxuc-T0=<*XmppIm`JBo-YcL?Vw{^?7 z=~KBl+odrbS>lbIom$(Mu5Ioc5)#DwQJ4ya)L|0TN&B-H4es2cTW?ynLtoIm$xJ zJDYmNjO{wy(Ylzy@pZ3=cbro&krk|C6quw@{G!&vVA@ldQcsQzf++B7>v=ry`M{$i zyOH5!?I3@PFxyPblUwUQublvX-#ljg6tt5!4e&r8BnrY!8$|3T==ct9Vi>!Hh_!J74Py{zsiRqagCxI7 zcL=Q9G4mNp12&S9S-VH+)Ox?nkTr=aQCblMeJn@bx9jP@4y@{R3Z56=Ryw~hGqtvS z-fZAuyHJLNQTC6)b<2uClL7&vfC8)Iy$VEm@6y1QrKPea9kyi?RM0qc5Vz^@ z?AC{;BDnT_W^>&8s3^AjKLQ6LUQ23*M{vX5raRw@CPGIY-3h+U5!!`2y)L-bV>pH` zqC0mmxA!9^+Uq{+@|!Zdo(c+_4GM$i28>AAVEvBCoaa4j4Qo3A zi~s94$&4;8W)4N)j!GdwW-yAX!pjp2{~o3uA1VOX*)hr_#+fptj+K#E&>_IffH8nu z;N|ILwL=F*@_6)R&Pwd>KWM}Ld#@ma&EJ+bo18t+0Y3oWVlrSzuYz_cda4{Ang?5# zgr-l=*$pQ|CFVUbi%K$XS##BZ@W z&%#dcecy?{^FLbI3?sZ|LtkLRuWzfL3|M!CT6l!%j>^NpwMKs<#R%8cbt;Fb^oVX? zcvPG(_Dl*200Mf-wl5_&m7))r2^e|+lEr{93w;Tvj7ly^qCf)uFHH_AEqRi_`Mv$; z)Z>Ff#uUBvpwjbzE?*S;nrQh&j)JXT^B~<_^yVZOVPxKh#oOk@wkBK`42r@{9zNCv z7f1##Uh-67>DUzbH7`m`=6_TQBYn>}QEr1d;=a{O&iSI--(r_KF;PkT_)PzV0~pT&XNXHyDzQ5qf-A1!zYips5iuzC|R&KkZKmpsWA6Vf*AH+P#3<4qOB~MZyIsW2`TQ zsE7`^4vE9fnNaOF$pabsTT2;0>vZpU!>Yd%v@1Q62j>D;w?#twDT5Ea4TIuUu4u0m z=NmV3d)acuwudl&{QKTCEAJysJPRyuK3*5ZyGsBhh8D3YS0lSd*tE@?2$Jhi$yyXA zGT3>TUb;HcrqqUY-anHBo>0?q`4r6P|Dzb*L#i>}q^MxlRHMx^?0`S_!h}u*I_Sib z%nD=7ZD-k}a{wk-lDznsMMA*1^l!mq#ZfA%(55Mp7`cvTWv3vje zmG~u?*JMeCd34e@C`nJj$VPf5q%igY_R2%$FAtvHG$3|XqT2SeY1a>Tmi;>_`K1I@ ztk2nB>fcr=u(SjQGx~iWKL3BrB13P$-eqAzG*wo$)SE8bSB(99dYZRmi7wiN9xnX*(nQbBdN9o{sJxoJTCOB8B5tah;a{rvA_<0!5 zVr7nb=t1MR7Gh-&AJC#VheSyiYLB_Q$jzidgqSZ})?hZMCxU7=6?FTViWhBO!p`Kw zulQ0eu$0(;SEQhSI)G7N8C3-2CW9ikz2Ia;r7Q1*$5?XjJ8tz5n4xy>U+C6_rjttX z)L1czalL8~GZCbz?eNHOI^UR>zR@FQ9=0va9!SCm(}D|>LV@K77TT1Cwi3fxIa7@` zWnnb-kLIvZKxd#Mg$DTN*lTecgLUR9%(&QIBAG9$q&Di?}gA47IZ5}G?=Ycy5iO@ z_=Ioqp}6u@lgqZJ|IJ!R{z>&GpA)9!G3Z{c(Y=O*0HQ z^FuP0SD+oq;(TaEZAfP*h$n#CE_i}oO8Z6Ylo~pGY-1k$w+v!;K-^X+3|_Hv-oCZ@ zrwBo7>gzx!}~V=n~?zIu&t)1n{2M+ zl@cqlij`nd1zR2z6gX$J!g`+08WwzKWwC}`jYWZ_K|Wz3nMC@2~TNf0TnDr4YORPxb@wKm>Yv2k4AUI;PWWb;usm%pxzwq3ngf z+WT)zhgDft;sd!@G&UvuCBEfR^K6AN+cnHJzyj3)PX=SLHc$S~#p2ME8DmuqN)1w8 zq(yC7=x>m$+W&_4&Az4EeE!&s<$r?)B(S(~Cl*6B@ugeXnKNeVQ;x^-B5m`m`z1*#5pt9&4Qo z>DpiR=6{*1@H=l&{Buj>MZY&v=M#3`w+KHqf-5lJ<`V8e+V?@~FJ1l*N0t8kOZjDL zn^uO7srrLC<;CaGvZ>v%(`)6Oi?RgcQ%%37=X-s1J!$jVo>d|k3?}cwZU+31`9<2S zHN*PP4}6zucl`6c{Z2N8f4={J^9D;N8Y)Is2+|Wvoy4-o@Js!uK8FkF!>!Y>Hgmlr z`2F%fJOb^eeo`O-!PmZq4~Af#c~TvCs4cR=ySvb(Ha5$&!hV< z!#fE1#=u8$1~$?ZdJQXlFZ7~!WA;6{Er`JcJ;*>V;&aqo6^UcmGHjuFvQK)hQFJ}A z?=iIq z`v$RLC7mgNS^v=`_(p#h!Ciw$Q=1LNT6_M!C+;eG&u0TdVj|Ty#!s2(pE$ylCU2Da z9Ji|k_H!rTPYLi`ZjtXKbSMfMvnd18y3|-BJB1$HALz9+Smyo&bSRQS-p0gRzSh^3 z*Zv}&@D0(A)?DCXE+_k#spCBeq8d|qj7+I2+<3|}c#8c)WaS4o_j{rR#n3J=-E%Xh zD;w#Fr_za)5_tFDf^ObWxg`PKo3&J^tkQEYa{-CLqycn~=~;+L64f)ci>ag_w$@?z z#%wEs5E&I%k%>e$^y(lRrse0E5!@Y#i`X*c_af=as1uMj5hyqC@(-y7zlA%a?(2gt z_cRodAyR8D(G&J| zq4965sJ`){4rKuA^nK%I3{y<|rp%aYT^mP@VH%Ru9Yp34wYcgQ^Um{3%QQQ&cAa>q z>f-;rG{n&%1)F}K@ZDG{sGX^EXClNBgAj-g@TITH6f9}H2W$P0V6Re9 zTNuiyPWNP9gYgpDxagCV2=j%Go&lyX9g65#gXeVg-NDO0rbc1|pHk=W`|-2-#QK;? zRo4ULHSE}t{EWGV45;LI1;bVA+j>DQka~bUEDJL>j5$zij@>z z?!a=N6xxqIjO4Yk-5+IDtXUAa7;401$L#*9`@;6w{YlgXtin|S-0%Xcclv7?Q?W_~ zuTZ&z#9bX|7`ved*mWUtp^@ES)ob(QS9aO`9ftH-Y@jH4wV`V>^9edkYf^!rfSQD| z^&-~W(Qb-X)UjXx!)7D9nx|BeBi{ALOPE?b!^YHwRZe49y^0`yHld?OS+@!TU~Rm?6Psk(#3+f9w&*De!V=9`(9<>fGy&o_)uWWxnj0o z98s6ZuMNi~HE*buYmqC@yynYq8^^suZR-F?7qn-^&u(gZ;2^38OqVoj6Qs|GttN5K zXH5Uaj``oqOfxN8X)z1y3$gdb;IshqhM<0?F^5kZpbr(OVg?3G9uC!KP-|j4jugs# zJ}m9L@mhq=%$&2`RP;Yj6ktB_yVCKcvYOw9?xBgg^O%x&Zd84`ReaI zkUTbatoQ%(^Q)nXHSPb-0x;zWiYO>$+IlmH1Ce(M?|Pu{=l#dshVA51Iee0eE5oMr z3H2v7s-z<_S00T;Br6CzoL32tsb*GT3Br4Entco3GQtvt*B5^_?v>U&=^?*Xv>qr$ zX3Z`xdF#Y(mQA44VnfdP4$3*VP5lslM(p02zDxL-VbV$f{U%Xaqp!4Mzj423?Uu<* zzKgXxNY@C7F;oV)y|i@zJtbz1ekF+^i+kGrbK0?V`BzJMNQ~^6n$@3-wKeSGk+N6C z3na(Vtsq$5kKGKCjSi){aj#U1+>eE^(M4{TB@Mts!43Q z;X(Y7f5Sex>AGnmf4w5<3Nr3YR3%tDW2Q!uK3* zf3+~#n%MV@8rjj~-|zs9ta&CU?L~_a8IeM^X3iK{oaSlQq~z|$VH4D><*Bdja?g?J zmdYjJLbjF)V&C+*vRS_lWvx-;oN*jgb&l%$lkEqcj{inJ)Y7i-dVHW!<9Pow>LSta z962$&SolfO!^Z`=To#%%45r}@6eZ@|9K|vz~`c<7bWV z0ixvk7(b-g!;dl?bhb&E*EqWSLAprt`XXER?_bC(`Vmm9(TD7hG)6i*#*!L?7A0+o6j`yshn~2AaLSc%U>EmSRY+y1q_L|l}h`+n) zy*|A?jJ#bO0pDLD&G^~dSkoBl&GgQ)k`U#Xz9&@UX9Bwv`lL~4MdCTObUjsv()}#) zIX!cZuKIQS!;Lp`7F{fm+6)y62p(B!G2{{8Yq>Zz)W_V2)2q87MZj&lU)zg)KNQ6(~(8kGprTqa2) z&#LsQ#mT+O#{!Jg5g%{jcw%a5aywx;0~wznCQxwo5|y1FTufgh3qs3J2Bc-mN>RWL zAnf^2NU<)2h8}E-s;dQ2l`h2F_9~`QnjBd4hQ$Iwj7k`m{i)m6^&Dw==q#G8A$nUT{av0rKEw*IRX`pML-Lvr(Qk@F3X%Y+Pon zTZJ%RjWzAZDJusS7cW3a1}Gt*GP^F+-HU6G@YA!K67~tvmn6755ZBvq%EE(#hIDH* zO_78I^v~X3eiOlM=}|CUj-~sI9*jNW?N96^P(sd~SVL_kzdAqYMx4mofrReY_s4{# zzeu)Xr|`3Hu_CXLWYyUn5m8<8^zqAJ&AP7L#fCNuj_Ihaz0L$vjKo6pHG@@^8`#mJsky8H5Ngx@K*ox`=#N3x4Ge{mIVMaIpD z3e9i0-TDU%eF6SXq#yw&$(g=mUFpg(jO21ZIRar-11goV??Vu^Vi!=n`G5^8gCJq& zP8fRG5IJ%6*L}GxB~s}|qsD;&S;ZbkV`_)XupXw4L2=T3YyB~mA1uC+=x ze{a@sRVA!ucJz2IauqsGX4-wI=Eyrwm}g)W9#WA3gD&DHdx4Rcg!xviLYE=^%9xs6 zcJYD=!T(I*?WsSFO$gSIBPInb)%hm`%-FfGWin)dF9zHYN=Ej__P3$wGXZSxF@h8l z{Va$zkI&{}o~2meBMB5^{J=x10$?#(!d9=%1a}W2x3#XDH@474E-T8;mtCKGfl_R3 z%GPxk@wskwSH8T@F$ZFZEx}*5@NM#r1+JnxNAeps1>bWqT$ne@tS8M%%50D@W>QWT45!Nc!vpn*d zd!Hj*I+O-vob_21_qv;v@KJ`J!HER|COrqq$v_4*W^;}%JPSRHU(+V|XCZF3GR2<4 zJj-97kIi%C2}N4n3e2r};Ta@;OPhvC?CUnH$VBnF)OGD0d0iMnv1h>BX~+gA3!CLr zo9zV2-S~hrWI-LuqR!*MTi?H@-EM$lbrdV99HP+i(0@-*Mkd0Ej6cEF{5evQKCVI> z%t1=Q%BtRF#Xzx+SDFrTvj7|x@K5W67pW6&065EH7OBgPZYYGT(3e*I&j<6x{uWfo3u&)CxHlC)Y73uV{2lm$>8!& zT_#m$HDee9ehLS?o$B^axZk2-y(2GW+PC{Ur$}i^4Ux%&PA%Tku{@mP0NUGJ(hjs%DE{%QNBTU z7n-aa6z78wIr#ngALg5sWq1ZPOO#c#Y)y^K_bJy}ywUFuWfV>$rQig?{Q|-N09nLZ z_cMz%P%dy5lDd@If$L`41WFlU{vCep3^|^7b4QC|LGGqAaY(r=IZ%C8Ab_OdeAuW3E9}Zuf)H zSib6~Njo3_53)0@JM~B<{bv=8EGDyOsxBHWWWNuc9;t*~DRTsLWk=_#nJ+f0&e{>? zTgLRZu)NYD#OhHhh<-xkQfx+Z^w6V?2Y^@j5*e2K!gGzs$rG95tcN`~&UV-}YN?>~ zhV^`N{(;U#uFu^M>CVK`MHJn?f+G97gC;RBp_>pn_KWMCA@52dg5%G{d$*& zF;=^RY6?MQ6bf_XMZWXjZF0RugrobjJ~2`j-VOV7cRk?p=g0g-a4ulyiG3TvBy`tV zQu!MhGEIkaqv{Sx<~0(QIUXCsa3tnVC$ekQS96d)BI9w`ni$LXDce10&cwkiq%|Of z*E_581Hs*dwo^bY<3uyt++QujIus}_e>Jz(8fO>d&>}xb8%mF?n0I)2i6L`gMg}7D z3K@7rtvRyXGvGbshH4`RF(FbriQ6QfJh&_KkSa%*m#eyy^~o=*)1m5?o0xgXqX`f@ zPpg8#-|%#7*FY;X1UBEVdCod9b)M)+pg`pnOhAyTImNa0XlgHUa*BVe2DzF8gD3bK z5kc_-22cN%!<(2A6gqGpIU;2Dk9k8Sbd_NIjG8qdz1RM-Kv>BLny7fZw}B(rY1Hn> zi(C-$o?wI;JY`rD2*!`8HA0X%?<9_pY{2LbWFSDDXm4JUd;Hkfov><8+j-*LtbVQq zLA;G#-#WnZ#4L2MT{pa|`+H%XHwz}OSxM&29}*2ft+f6KITr7E85SE3Gb^I=1wzW9}X@E5U5-C4Q9tIrZ<%_1& z88x9QFN}Sq9Dd*$LD`2rSP?=TkpU#%gBFX9r~Z2|R>(Mx$Z)3dZyP@HEFwI&iBGsQDPEkCR)V*6Fvs%7TVmfac&VO4j;s{Y%ZEo>uNAC&5w!rx1X2A(} z0zqI>z??1p+U{EpgsCY3^F5=3V?g1!%|tR|vD!&pmiVt z%Z*e1ri3a4MB#PM>Kq6^`=9ZfG>od-0pJ`jW_^rqtR8F)Us?MD!=%COiLnGq=`S?x zs|{At>wJmfpYPt8U$}?F*}8o6waDtk5-7n~J@80N$zNP~hhhfwG)Ej!kMH_}BOpk9 zE{5R#2F*%lvjb0n-#K`o(D95DoPrO#0k8uWJf2ydO;xNXyNjO%corS=JR{Q`QN`*u zvw-fx>;%-J@m7K13%n66$1xaP1PM6PuE5h`CH;u%KbLb%TXeiD;T=KzTgux%%LlK? zwRTdI5tOC=o|t;ah?yUyo4%Mb#Jl4U_%~iNr2f4@eK~K1~)A3E}}SeS~`z z{(05P$tp2CeNw*;7vk(`H>J&lh`Qkm4Kim0oL(cVOlG6~EbYt8s9NB*?eP-;QVIqR z?zNf8H)#Pd!h?)YVq+n59D>l4XDK<)^|^K(U`LYxF(OiHUfOJ=LONaCr? zN1AB@=Cw)!6YjTnSjBZ zG$zO?kR=zIS&W>|kc~2JFV|mAjhydErp65%d}20k?4;rGL#Hzx8Bf86_>Sr4xA2Uy z0o;Ao_7-y{i4~AGY7=?gz=K=$`@mti^(5xv{h3 zq`>n#8!@)`#SnX!+n_FCgWj_*5>#;wpzX|4SI{SDk5{{>LeNx0UYl2InsnjnL)D8@ zTX%=GHd}sKgrFhu2&}vvfO#mIOM{wp2;9Qn?lk^9R`zq*%{nyoS$&9<*K`RGyz|c= zc3+gf?kW)QJ5j+FiaQ)>sJD~=F>r=$P}=mqS)89Pgbp=@q%@z9Ac2)}#K(oUGwcj_ zhY^imV3J%^&glCLEZ3MG1@wKgE4ne1LwT0zA7&K^m)O#W4DcW+stW^T{ARj)O5)j7 zeS-SSn^O*8gXdnh;tzW);nO?6Szo48bt6{RSiviR^HBQ$rwhhppU?^a=X91LXF}|G zxMG)2L8RQ;-HEX-fy|)?whDlXS@Q&LJ*#Cjt zY^2a9q$@kP-X~F;5DO=P(VlQE6o~m@uR{nSUTXziZs5wUt!xS;ok{iCwt<8C986Pq zhmu>IZb!*>z-T?xsvqy`!;vS^+CIK<02 zNq=zywQcspq#cJjSzC==f9`p|pVup^GnxqsPhX3+{3ZS@!%Zsg@^G7ORVs>!yE3Xk zhLfKMuq~RiVO0=KF%uaG^o76%_@-ZAfq!pdEU?ef*+nNBXJ3^CwPaoSUNm|*__VsKIVD1y7X$JQ9N&n0&9^-FG{g4^l8I zJ%%4Y8$EErW4LaBMYj=UxFzCl3wFf`6J^iU2xzvAmX16#4tD=q;uH{g#>BMhP0BWa z>+tT&3go7$TlV)gg}v>FrncGrg`wL^I+C6`Ewtau&77E^i1Y(2L}gJs#kFqiqR{fY z<<+WZ#fJlL3TNkKj%PI*K1vp?QAnVM#Q>>($@f}r?FU>b(rik(Etcn|X}KW3>TIRA zB%dU#e5vSFe`Jf``g?|5ly%3!aktVcZ`=G)a%qgR2LJspbp3T7KW+0iObV)x0zfrlE!k9`dxy7?N->B5G@^*5Vgq!+^O5H@A zn~ZXdUm$HKP75WgI^oDR>bc2#AO2Kwl`Tw3>WzWijU)C^3@e;?_~N;@$|X>zwO3ae z2UbFX4_bzQgv-o$3^u!|6MX?+X-u?YlUpX;eFBMeB14PFeomw)VNjvX(6>mt?$y&8 z>*S-ar5>SV+xx)vZtR%+l!t~D8;|{I`f<|VjrEFEm7bB}^H+$1nzOrbWkWXzhITcN zsinv`JJHX{YCVZwe$UV}w{eu45iZj)QHNbm_q^{=4k=#T6%w?5?8qGl8Dh7~`=jze zI$T1de;yx4z|(?|7(X$xQzOmE^p!^k@bq~3vo)(aaL~h85tUhSd`?7+6K?)7e$9fm z^JMsmJjuZ*?6R7bVyq`rzvBtky`!{lVGe0p|2S|J($C!8aDf5qlZ`S}#f<{#Aft!;|sjm6zVb+eq4%8ScEg%g@!WHJ*}B{k7Sd&!zXuO zm#+Xp(d=E~P@4nU}{{Izs*TJiQG)y`LJENzJ?PYX(HYIL~{%UfIPv2o%%Hvn$xaR$L3OHvnqj zoAS{R&=D@#F=1w9F{m(r`?%Mb&#qCk)I}g_G&$z5@pIEc}o7?>UW1jVu+|2fOzWhO6v(u1nX*XpQull1`|<#?5RwXh>DytB;W_JK0NqoF{TGaOLyOnZGnb2^_%m_V2bsaD1UU zcKDVgIX~PzhlB~7vxm7Ko61520bnVdNq z4(&364u-*Pj(xaKV*oeWUk!!0|AH{2Hali$H`r%LcOH|q%P3v|eVSsuHHa+>&4u@p z`q9!UZ?BTz*t|Zmro)hL{7rtbho_ZrpWtNT%fe5S;(7VNUt3q^oA?&+uy^rL0XDGi7M;Lo8KR z&b7(j?w(KtMPrGo=3?oLc3#6g}Rsk;t!2^ z{mV6wNYj`dgQh3&v$>wn)g_%=R#UJw1Gt7bW;^~`tR=+k#6B>+Sg0WGbo4mj1D<6|!O08I z!)x4IEC`0Xou7${zK<`X%dch^(*aOj9E|%}_gCVXyPa?ETU2$F-E^6%=*$YfNN`uA z?X*7ACY4J!v=e0F(!KcF9St6`WKGMC)-mPXD_Kg=X~055z8=O-M7PUl0t6~SWF*Oo zP^39469fBk?`0s>$G9l_0_=mvZa&|g$ocXT1ZuPP&%@Ssk@H;6nQS zF5P%0A4hEf1Ev_ZJ6L^yWb~Ap2+MisqK^y%8s;!r^zxM9#PMTTeu0 zxx}Vh@Qg8nn0C~5wB~c63_$!?Lpy~*+!p9b2Z#56@;Ci0_Agj>0uJqu>|#%BSs`?r zBcYZw+NekJ%_pQ>e?Y{M__&ruv!ekIq5F{;wm{=yvnoU<+id@)%8!4~|11ypobTN_ z;lsA4ml>!WG7wh$>4`*(5AuS-Vx=P?XbUb%|% z3_J5pPzvb9M&)?J`9F^pmvo3Cb`ahME-d|(UCbWC=ml~CIt!rh&mSl}PE8}~(1rl` ze!xl775d`>;A^B!;ZhxTiRFxIe;)o)YB#0yoUp-J<{w%t?vQ6r1)Y3%GtBhl03@H# zj-D|e_FH9)h(7+OISelPBdgFosJaS-^=qmAhB9}Tdxd{d|F{$AYs z%|6;zAFduQD}bZpaey`VbYC09kv8|l&rjqOYbaVaNc7O5=f(=`)QA_*q5|P1&Nu?o zh;v$H7*fy5SmzF9MEwHC=FYnQDmrl=tkO-OROx5J5Lfhow8R(4GznJ-6Z%0#Cl~q9 z`tyC}c-b06S<_?by%eH$RhM?+t-!TwNzd#k*0Qoz> z`pBanuBHl{PAcN`W_xi9u4O&FKFBTTv!U|=2e5A#T(GN;`3q5O>(E5}h@X4**FOiHx zGhWb*TmRWp=jsXRG94XnsJo>F-~PHu?DY+K8U)2&p1HP9L}fM@$b@vqL{DRAWLKFZ zn~|{e6PM<#;R|a}<^?G&f7}0b`5IHxsuC~F?};ui`T2=fd^W6*BfqP|HGFmT+<&3dW0&4RLAkkRl-@ckT`gBDL6k|cgA9v4};l! z6~*VD;qW3PO1z&b;m-QG&@f?VhV*ke5u_77*UatJv)dMToB|2V$hCzd!0Z4x53y)K z+AN+~v=hdxv!X?lCk4#@3aEg+#6!O7yJ_L;XfnS!6Xj8Id@6QPvbEbPD?aO#`zDe% z3fSXPU_v|@lwvLgNP9!hLDtW{DNLfmIiSO>P`I+X9xG)S0X5U*Chn(SKh;1No70+e4U?>Hjr%tTbESH1% zh>o70@;2PIX_*83eLxrJuYp^iaI>aiw9%>qnI`|ualP5h*1{j?Fi415AA_;V1wC9s z^}27e|Kx87#T7M$z0WcFCV}I1XoRrKsy*{At^dYVE-MX^WA>6*tk+J-~aQ~99OHxj=Zl8ggGe6Fcn+ma5I z>%@85ffKIUx;iu3gb>kzH}7v$93)5Oc*QH9tDAU-2G@HKN+QHWCd>Q+=xs17T6VOs zfqVS=J!v+-@EaUapPMZh&`x%Y>k`K5aXZ7n}c z<^*CS`VPT851M$i17V*Hf%+f7icBTmPy|}DXODxbXYvQ!Rf4#na_MnqY4Ha%bfySE zLBt*@6C&$bc_@A=H!Us`(cFtoocxKbSQ4Xzm-UHJPzhagmjaJ@V7O@UL9ranXzL0M z^}%7aOzkhHcwP;S%_1_siguSfbItf*{I^?XEH~FVUNXnoNN%ID%p%?v?6^uujO`Bo zK1bwlvftLZJ3;Ds&FFhU9ZJ7<0p|N1J9#eq_BSc0E4n(Ou2?p}B6PFp5Hfcz`*yNX zj4Y9A2FlD6E^Nlt6y0_ZFs_wQa=W;pTH>|*PzUz~Gvba#ltRr+gQmC^VGO1Ui7?=W zRNLr|zxT>>QX?YeC&&PsU_L^(Z@|-bH$&|mb8ZtznqtWY!MV!Qk;2Pt{w$dOc~q9WoqY9@q*ga!r(Za(j0&H8Tcy z&h;F`G!p^7S1ZS`{}ksCN=0Xc-yR61gE{8;q7Ov}q_#RX*k^TaY0gF(o>WHgJz+2o z_r_4m_c%;+g_g9(pdex!Wcw2Y0$|o$D20i7Sn1EwZ9?5K-H!=QmuKr?2mtXRSE~L8 z;@|i5u57BC((%g%#nDPH)os)C&hbq=rmmuaudSTHq_<8_EaMAq-$t1If*VfO+xMX< z>LEbH{}9}vV_{1iRGDRTEqY|0n_$d!U;}js3I+sj&*q{?{_mQ17GWT@#60bGGCR7D zXeArXd2!J;{p1^ww&jN&aJ4rShc@Ff_pO$2K>~tc;{#aYC4$T`J4aS^HwAm&)uLUx zXUGZ#@fl_uhZ)(R=y0*NiCQo(`!sVTV=p6I4DH?Zl%|c9M3(w-6DWnCoEv-ZW`_X| z@j=;y&v#NVPg1M`juy5WoA%;b&PN{c)*~vsMrdcJRnf7`eIH>x-S6v=1>df{fj}Ea zwX@30H=z@+!Lro>_?8CkQ`vb4;Baqxy^MD$s_O8|wL3WV2ztWHRoHcG;azrJXliu| zFPjqPqjp1r!LaW8@kTi$`5RBhyOv;R=6ux8HGYj;c5O;Y_9RaObsXZT|Miw2xyW=( zIQ$nB)IqNRTE2zRS;WVf7^Dt zs;Y~Vq(a2jfLmkWP1=~TFii~2d(p=l%{tL8&$>97l9=jjH6{ep$nQC%AvXuPsFipP z@7}O88OCHLax8ayq}Zr+>s^8Ry$rtw4`3i8v9uoomLYrB=5o-!g#NF&oZs*=Dc$c% z3x^J+6uYd+lX?H|CScbg$mFBrj6OvW%=o6Pao_$bi>~vLbJEh(A+Qs#mAxJ_iZ&Ws z6eQcfZ%;3~zO}{sWV+g_m(70Cmx1*8dsiozP)(RuLdbDd2 zlmxYhGBUm$zXszD&YNWz;AK)0Q-91mhU-2mxE#fVC4v3n=cdQ9uzIJym*tp#p3C|) z;%yrn>p9O+z{y^?lyf;=;)#Q>5^pbT^A$uwhfG9LXqnC&J0{`NP2M=4V^e4l?P>8C z&y9y&_rG~QCSCq~%-}K5H5#YCRGh+3?6HC#;B#%1(yattXrme9JUFd7G?ZaFALw+& z4dKw`3e;tvRUK2JcWbP;i*|vHMmfV&NX)hJpp%)uP6)4S+D)}$1*do2&~wxux^)U! zvP6&WlxXKc$D$+e?iCt^1N${* zU!WZnGl8Q^!{Nwy0oLikDhM4kFWz|8&Q86yg}800Fww6zD&M5n)$QOh-7%ehf0){p zBu|}aF4z)w^bHK_lQtz;Z*2C~yOa0wMG5ZcticLG&&e`!#8WOsr(rq5)n@G}r zac07RBj?_yH}(uHZVN1ZU{U4K`{EdnMMCG%Tx%e)4~OkbAh!sW<#}!~yUDB*La*m6 z8_b$77_rc4Nc zPq_502pPYDH|fE#Pu^yNy+|z%ZsO0-tGYHt$x}OX<7?}DrivO`<~h~#{RI8e^EF_k z>BusJWA5bJq)GEELxR9%*AHL6W*tGvg&}~6D9a$Q#%tAK zrrgrnBRSP&mLH#z9bHw`%=eO<{Aw3} z$M!c*x&!&&cx-8yQ-{)u6`4+C-Fv>aMT|+>oKQM`t*aMxSzR^p#tEzE5V2$apZ2cv zuc@qC$6=IFUvV7Epc2tB5EW1mrG+wfqX;S-niL@jDn%hAAyO?2C2t`E_TIgjU5Slarz3XJ|{U7d!$rs@#IoW&dwVu_UwPRaQpVRtEVpv=(kaSh` z87B5WR&up|1t(LA4IJ})5TfsD!dnmk9Iq#hwF4rh6Y{`TSs`-M+u$B`chvV1G1*a+~A`@bjN%#X$ER*+X&;jn=(-nedt0wJkY*FvAMPAq)(v$%;>Sw73&ys#t0+J&^K_y5QQIJ zu;t{|8jx6fFK!>+@0>JE$UO$NyWFFputxQjMon{4L(RZCWIJ4cP~G03le1CFD^o~a zlNX88&CT5D*8LcbB%}a`BcgrUkTP=RonbVu@0|)F^-R>&kst6RF;iAswU;pMJ9*?{E3fde-iys4Nte$r#7U8Ij~2 zGljYcWnt?MGLBb{+_QcJ^z0(LzXUcMJP#WlRbVc(XtoeaiuKAp%pOkMT8Rn9LQDv3 zWvv_b+U_B8MoryPFCp)Eym7VOl4>Im&VlLn;o~0gxrT4MZnWv-IJ8y^%l#bpTJ&9J zWHfw9MTc7+4AcyB(L}*_mB}*(?m&0|m{oAS*2T#xU07R74;pqrY;bGq)lA{jlLj7b zD}#$Ay>49vxtlTyqJvUMPiNWLXtXi$pBMh>m4X1M5a;6l0dL^ZZ+*GvO7nim4@3S? zn}539(f9-O7K2z7e?dhj+tw>t^g6weI%HDux^R|O^ zIs=6>D}u7!IdeX8(Eo5;EWQf)UX^L& z5{;uam`h!c!I(U#YK&0BR~uimoMXcP=PE9NS;` zRA}W5?l*bX*-)IFyeT9lNvpW3(Ev73sUWzOq{;QYh=>9vw7K%GE;iZ^?97nGsBbw2 zY!*v{ix9uH$~oJ_p1RaZ>1?~0+0|)q(FvDu|xQjkeIc1lY^RptTmt z(9dA)&t_$*+&6E&&1$nljAHs{CHglL(VET8%t833;*+#swJ)XciC-$cujou$ZT}J< zx;(9N>0;t*75F5o68)-d%8h0dUXL)RY)_NTIcn+t5!8E{b^kU}T9yh$#@EU`P1cBZ zao*o|SEFSdP4d1ae=}OJN4~9}VS2PZjV9Z&6Z*Ingm(|h{3E>nrgy*Hd|InH3n?TS z0sZS6PJ8t8bQZ5?jg0`pKg=2#_>)9IWwu52#?p3@zDASH>etMs0J*PqYm&*)_Fi#ae)I7~9{Cxp zSz0Jy+TOUP`~N9#YhviXARJGF3{E84Wu?0@5OlzP@KBE{j_yJWQ=94lnP{cY)#k-D z+2p*9KBd)qMa8$_<>u04eXj4PH$n2G#K&XFQ(B>OyMagXQ%K4}{4}JrKy>6B!_?HF zUaMv#8-2(euZ%Ff0LMGJ7L=+ElnR^p)AU%@-pEG4zOG?>7K^~_C~s=yIE7|A`kg46 zv%OCNAib$jG*cOzMo1_8&J+zuQM z=dECo*C0+kYcb!EF)^{) zsD0#_1dc{sX^qkJ%x4K^U8g1DFoKpwD$ktrILGJd&>|-1B|l&4Ca`5PTLTb^11)Ub zq0mBmqfTtMj>7vjmIS1EhA6RXp3bSXCPk!2X~4|HJBhkVzBX^OXcrvH8Fa;~QSo)+ ze)S2xJZ3!KDu+g-Iy*qoaJ&q*jQj2JQMp`~VybM*aekpaYBYIG92tes?ZWfM?S;KV zUDtBnQ@__$ROx|-(=puttl@)v-xHiGWyq=kn7IF}xHjNVkY$n(d$~4dBO_S^-<+N~ zt#?p-Ppf9YZGMN@CGkwH`&{FaheHNfEI|VMeWjx^y~z1K13&#^#zQf1;hGn{^$O5~v_Tw3rQ);c zh;cSiIntm&DorK4ySE$;!u5nrzI4eKxUHErZ?4byrp%wYV43rEaWu6_Gpo?Oh7>D3 z;w2E+a2_f!7OYF7$CZG_pxtq52U@z?U{jr+u$Lcj<)N`?4+q|U39-0kpyw9yHH-X- z|5etHQh4x=c z+#hziS$3!k>ZKAs0{ZYOE6pJa;0E)`s|toG2Zs-!DzKGUUO;&FM0M@O@1=xOGUC$6 zDw`Z?^x^DQ7R#?M;N#c>R+|vzg}pf4Xap%yhUPYa*iER zU%Aj?C2k&SW3_Px$FF5s9vIh#(?vhq=Q>a}*g3F&!3PP2{n;R&}0Fc&m*dy*+LZI{#_a_VJ zx?d#G2fQR#qo@;5hH@T%|L5ndLwuya~m9VOm^NH^XVOxY=Ot4#$VVz zTyjPLkxG$5o!R`;^bxt-lTl-Gn8ZUU!7MRsd%^2C9c?3ht_~c8@-|Xpa(@6U!Ferp&5HPa9sSXyU^3p26broniHSt@lE#>VK16eZ_Q%uIFrvIoVwe@ECpcy z<7+g|^l!P3&c$oR_;>6-XIc}u7u)i?ue8=Lnqga~k z)hQWLL@X_|1qc7&=zg@wlPSY;>KDLUG(K-vpaD-;v}>El9GL@c zQFkj7q?M(XsHTpBd^UDkf`{Wwk{kg~cd=&s|0-Y%7aZTYAO_92Y|S z$wuc0XpN>NqK#W{0&%9}OWY&8PSPGxwvqJJ!lO0Psjk}9^40Nb59 z@chpNHrZWw91l6-F0i1(#iB6))!)~Kq>M>33g!$?f~ik_(!YM_;@7PteFATYp`T6Q zubLN0FqeAc>%@a46t)rXp=j3*P{!sw=@uV_{{@e#YJ@EgQ9&g!snz2U4qzJ3O_gYH zTSZ4KuA#mrh|ymsQQe;UY_w=M?DM5cY*2YZ|0j5G9f~I{s7+HKBsxq`;w^HHMtkTiur9^5Zf5tj*=E_4I_LN5JP^uk52?AH{wC>||_d30tyD$q= zH{LPKw*8EjaEtC&HTnbO|9;mpN&^L@RXSN{8~FFTUBhy@yOI<8D;{dtw_}~tBQ#95 zl9p^4jmo-ZgvM11=OJbyWeFSn_VA)byCN%}q$Cv^eX|8h!YMFT;h1PeyuY*5!d=Mh zrjPgjSAt0s?bf!o%DO7N0aC>JhZ@QOX7Am?m`p8_BCN}2WAWaN614o0>xmTNmDlQbMBx^~ zHMrC4y9zl2<|)Pa1wQV;NJGKxz$`*#3^)!~J8-)fY!jT#_@~VVmO)bp?lJ$BE%$#$ z&L)L9B=_$Y?TUw^eF-@E9yPD-^A(_bGD!*54{{nKG#bX_$f_XVvr|U-^NWd1o7zcG z$Ex8RbKmP$Mip!pt%!Wi(xQu6HX#f#QHwuiX$ zJrv__)+ST*PWe83jXdah5Psn)&eUpVuJaegOW9tol+2m7t+5nYo%n&{@ouoi+h@G5 zq2&6OlLc|^RU7PL`~URCma2y54cxGcq;=_`D7o-bq5z*KVqO34T|M1Mb$uEJ{=jPi zbg5HyfADuYgAg0VF>wz0?0xHl88fk9>FbheyI60^-podZPX|nHhjrS;L6Y8=tpTW_g}`{1HZ5G-<`kbziv9(Gt{C_ zTbO@}^Q)0B#+B&u9IjkYFTwMYagd7Vu+G5t_F5Z%)>8_f6P@;M+vT9h?9U^bI0OdR zZpo-FcUhR3v`#elJvzvFCiVpdz!12H^uVGZ=YOaHQ=HqNL6>*SPOgt`=qvpu2a%@D(J82Tjy{yPX?PVj3SAO4xp^mh0ZBk;JJus_I=92nY`(W`eS z3{^oIbdydC#zN5kkq)JS%6Rxpgf-IU{syaE*R~mED+xamYSCQT%?w$uOh3zz5m|RT zc3L1b`0(89hlTc0gPklkK!#k&D?;TTetV<_-1a)Gwx^U};(pMsq8)YSaYZb)G8#&E z|NN_YG=;pq)+Q&dEuL71P%P1?&OJ9H3oWJ3T$u0Kz#0+Y6vrA?;JYO_4jW{FX|hDV zYeXJs`H$rlFY=az`fX{uIRNx>nr{Z*|5NTDKbv^_xRh{mgQkI^O(z0+mbki%ThOL0_PmY8d=Yig~DFzJ%&A(|ILvt%V7>=CzFtEh>YDN1=z(rMm z`%4yF!c|W!`ua>ug-m9^c#|4D%9{U!utRvuV-X@(!zOHM>oMYf2?{#of#3GkWU5_)QJHCcy)2U=Q(IPv0RN;6Q7n_HjAf|k>#VbpWCF} zvtMAa4Jp&*MJc_M=(|7J4)*{ccFov(h4F4%d-I{-LM76Im4(twwG8y+d2`hz=F;&k zG-{%)CtG2&*#r z?ERaB!zew(!;0uu3CqL=)2Vud;zpBi3t&OTrQRb+c!YdOT*zTbq)vyNKJhj(gC&dh z?>nEoyRBF=@;eOIPR$_yRp>7fH2249pRrCyNhO z+*c&ubY%cE(U4}5$gxF1^OBfCLPSFBvt!5@zjsNXpb$0;b-~;Xn*yy~ve*@@PDXzS z(ev+yx7-p#9vzuELxQv=Sobd$g!CMy|5=8ZJ$>^NXf)Q^c;>0td1IvKex(Ws-VP=3 zZF1bC&|RN8@z%z?c^x|C))m{IEzy6)(c?jw6rM4{lBk0u#TE#3$IimQ0q>lMuHy;U z!&oxX&6`8B#(VedhvJzsc(SWSD&fQ0?VkJ5Hg}8f8lz0mir;uf#3{j^Z*}zm(dVYt zK^h|Tk##yK zxlVZaOLE*V8cM}D`q?cfQXEkIxE+`1ae!DCz-~O!UM}EEbK#w9j9yu92@1SH$M>Br z(3y1nahCd8g?B)ieiAWAXMH0h1}#{i?Okqy$|^GRhpH!|Was_083Frv_yQ~9awhBR z>t?&edmavVeXME0>%6?6gUtC04Mit5uQ77J$6|ZZk4`J%>6X8kU4Ah%i>pXPr*!rr zGs!G=Az>5X<|ep&1DVNIjbu8cI9qn$3icN(L$Qr{y~|nYFjSF*w-81KWQBJIoW&eA zIWr6`Oy)Y8Kp863Ch}g{PTopV#E=r*jG?VecXCsga|Koe(_f31&1w@cw|+4*S&6w^ z6tnTleiQFWv{e)NxPrht+xuN*{5gT?zmFFJfeTH(NRZB4x=IV%{JJ5YljD7jp*Sv= z_XCVjC8Ks%X}MHZvB;?qH(*X3=K6Xvw9#1sSFM_-P#`l*ai%ehOuWl348q0@pt++& zx7#w1605Ye?7s4Fk!r2^uX`8Zzc6NL6L0%f$FKTR7}E@YH%7rF8IN=s>kg5x8N=wT zcK{<{vp@WqR-=61E7i!TM!4AzXL@7Zs}f10)7S?^<&u0>5v2@xY#4Q!HAcpe4Dzfy z>gPY9lVPvq-2(M@)b(a_0k9B80<*(;lP0YEklKwWbRya!yTEY8>t-D`kKz=(zCB=C z5O>k-0k}g=Eszh^IC~wOPC#!)As6gfVUVq9S+H!K_;;xa4@>-}7rxpM48-7J z3B1E9PlNl?T4A@5HcvA@4)f)Ud!yIXZPiHH4dPTRKSvvAbOLkuJB-TniMQ?%8aq-> zOb)#ymTU2t41HbRMrLC4HItQkkE%~k`7!R&nvZ`ArE-?!Sj z12_E{XUgl9Um)^xqQ=frkNf5CnT2bzg4BWn{21*3=B}u<22;!+k0wQ!F%p+^Yqk=< zy_pjC#Y8nR^#>o-T;td5C7J}Z2xa)`MmOL0{fVQ*)qKM(%F##d48dW4XXxiH&B$19 z@|T?Tc0fcG(?QV1z|@K4`|=iQCnv4>IdJV#ooemxQT4Er?i@v?v$L1+(nQU%P`de+ znu_&11}BTHpZH1a0!2(`Q)J9xEa)&iq0(m$TF8^WD(@M4g>3l0-|AwjP{B)I#$o^d vj0)mkIsB^+|LVZMI`FR!{6Erx_upl+4bL8tO|6|pS4BKway$Nkxvomw&+BsbIIy>z7eqJ;`MGfL|cySuL)CYHq-_WwN;Iu?Ey`?eHH=S;;xlyFQ zbF5uoU=;HuOxsB^HO*sHgT|Zm6bR(O>5*C96;In3TidNKT&V?~0@hf>{q+kaAZL+_ zY{3X{3xBP>)cxSG+2DUog%a7UN2a*(H%BxhKVd@jsmhu<83Lth2?KipE8xhG`wN70 zEq3eYg*z4>ectwBKCQ$>=&S|nwM;6OP2EkJV2fX%R^9vK|Ftwu3}zgsS5gy$R{;XX z)tTF~IiluxZZ(gicGsa{nKrN)0hv}+Om zF`+K`b0zJdvRfS|u9$BPF@*@IaHqcETI;D)8hTh$1n)h1L754h>Ajh?NpX-)m6}4z z&pfQnO_?{6&pqXM&xquW?2qJ(%s_DL$|hsUrNU=aYy(SI>of(lNYjwlqmd0N?^bc$ zTxWc9ZOiU0e;qttjw2w$^DYS@yWPu66UA#N7*Z2IHFHFJR)qdtZ~?5a~Zvq9$O0NB$qJ{OO=OlS#yigijre-3(YI7MiLJ-pR6 zbw^fDvP;%mPp7f6FdR8dUgh#FODb33smrUTWFPXCBg8QuRT;9AK?Hwc+wjB8U~=Bu z-@#9!$Nac!G0i-RMuk>yj&_gd&~02I#+XV$$LB>J_ca@e_HX_LB+|}X$_@FH+^}M{ zU@lO-Q@E=;u`U6!1ukxAs$ql5+5CBYRqu`hQQl zO9pyPDosL%s|%W^uyfJI`RTov)l+bGb(|+s7XN9$O-ANn_)#LI-b<55;z5eHFg>g+ z+IQ-oa|AFflS(? zZE+Fu`iQyvLYFrf+N)UV+Y31=FX0RO-XTqvAzma(akD7tU2>xq#~ETQH(?oTj2N!M z>UpG(;myaZP8XttQrUd6>3n&5lp3v~rvEh+c}*xY`KyT`FYU6%y;o>5i~W1=+EAWT zUpkEx!%zs{5%X{o2JZx6M;@j}t!)t2horB366XQ_!}#)xnks|cF3vAzH0PmNs^G1^^ju``55P+apptCJA%}=@f2s1 zhV&%~)7;T9C&^f*EzT^|x}eO)oBSlGRXOjAr0TOsGxf}gNKp*!G%L9HwjLkH*Hx0+ zY`~nxUY9TTqfvVK${}d@lPyxfk$Je|H_$M`_*Uv7E|;glQq4 zy(8{$Tu!A7x;fa9*9O?6ye0VeKF@M2?#rH#g94V9m3Q&okA+u{Nf# zQ5z#y7i_g9hGok2^bvx^k+a*{0DjN>k;CW3l0`N8g=>fSMkSn>0|bf2aTb?M172OY zZ8z3?M%XMrlJ=yqN)TQ8F`582nCj_}Kh4QW&IBx->KMcj3;)fHLyeZiO3y> zxx_a`82+!t96MamB4%y3zLINYtImDa}EQ+co$B=3lq zmK_H7RgRi079g)%*tva9;zgB0#^NEy^ z&!5~x&Hr5t5^4_%jd4-pzgH^A7Fzq0$2&cE?v_te5KN7bQ?blHFnRS2;?K&1Y9{((~)@E4TkJaO=2Apfr`i50zTNXtM>WhVF z+GU?IxRGxc)#56FvK=joGL-@?TrMM~K~GnhFSLFPUFV`$4#I~*DEA*@yu^Bt{Sh$3 zw*>E@y5?@eIno)Chzk+GO9SXI0i1ZDnOHxVq-U9HbzDaB!#3zRpm!{$XF22U=P72n z&P^1gxKXm6^7PlcKrm4>sXUsteOIVhJ*n^DwfmFDV_54LYjkfQc z%jjt5EU(nh%#Ces3YKE`y}I0+8QSbW`{)BwEl1B=beTfgy~IKrCrx&al%S=RqO<-y zqZaoJlg8)A$i6PLq{w~$70ts6<~&9ZCUA@OYZt!P<)*lhxXp`9%&b|z zcKR6)uy#pY=8Xqpl#9Z8$$&#QZ*9rfLD_=TY6*FWUW>AB+(^mJk>!zpEUer(;y-53 zj9POWN~x!dz--MQ2d9)oo=yjE>G$Gw=OeF&hkfr%DXOddzU~j(aaC-+MX*x8Qy+g! zlwxH@$09@TRh`1F46b=ZloD#&UF5g)D`|xcz51bh+>!L=!CX81^dqkR1Zqa?rR9C& zv};5}nvz~%I(g4zWhRoG1r)QDHVgoRmMufXfBuQ9Uw%08PM8F$URSReFOavM&;O6& zh{Ih5Lh6e(BR`1=)`CS*6d|(+yV*vs6XUoNcBn$$86*FlDP@Od+mqKLx|{7Lg<_Z? zk&ZwV6Dsh$6e3DleVfi7>;-`Hv!@GS9jU12!>QGok!O6C07iZ*pXJ>-s}gcl@X6fC zZ|%&g_3Ohol~VKhuYi~(hRXlGwA5jxWF&WJih+q**VX%&_ub*n-r1+Oo#6s8Uh-Qm zWFQL_Aq!pS3ys>#|EWL1-pg0DYu4vOSAAgAU(tse83(q@)P(>bdY=SH&(iKcIP&HE z8Mkh3{qv(-u`Dp?r1nqLE<4X7n0jQ2%(xFN^z-PV|BOTsn+P-%2x@&cp>Ig$dBV7V zubnMy(?RUvKRgBoP}1iznVc4Cvx-8rj$#j{41QmSH6?e7VA)aDIT$A@TJM#Tv$0ZC zR6b?Nv2Ye4uUU)og=mV$B%*64*Emo&GzH}!R+Dx=E6|Gs?wz7-WYb`f-xJ}7^>d5` zA)h*)Wi{t{kh7_6DsHlD?vHFgd3y(%2MIq@ft8F&5zDi-)(ssgZBGvFf%_;6_PmLk z8m1C`14IT}Ce30dst}}+5o+(ZhSFSHu>*PPXXG=T!r>S3pYb=6#qZh!!YK-qQiBC4 zs*e~RI+)s6ir`OTpA1EMf>PM8ywb3)-a4|XYWx|u)u5WRklWMz=KOmayx)Zv=-RYO zVtIdw)f!Vp%1&~c$dTV6FfV?yoXWn?$Qdo|0XWZWxxsy=U?dFtsVI4{o~Js~zJi_< zI8_ej1H=Jasp(;0{z@QBzpN>>F&tH}KL!4k8jlc^%2mP&z&MWtT$Ks-IV3plqnhgs zAg%wnYCW-(gS=LaLmxipQYv=%6UWS`cDsmeW%X!v#)X^{pe{<3;A^a{zPtu{^o*eQ z?n!>W&^tAzHg7Hp{N27V#CL$mzJ@gddWmugj<$Ji_|vXlPA>0ExFBCh_B7QM%3?ix z!RZi=U;^Z3Ww8_M+H=5QcfV-7|K>&&K%8F?dSq1tG38Pc4cQ}Wz8-IAEehf{xZet* z|Lz8S(BjrCeb3cJ1?)Px@P!AzWxejnvYXeA%ql+SzB&orF+CED;@u9v2PtA&ZCiNv z3)x96y6ykexI>RK^rw`EzYB?3IhMEDLj_9ikYb^eEqAABSnc;rdvr0m-s4j^rwm}~J$zO$AT$VcR&|MtZ9%-n zd3R4pRNCdp?)R}T&^S6MoTarQ4O{rOa4in>buf{W=^RU6Jo@|L_KDk250jV50%tsU zzM70pvKAqcfZ`cox6A@g0zHYq`Yu>8>@3dy6xIN~>S*lPS6_8gZ~Pjp5<&E3a+3Cs z9o78ru?E`MNn+h?m%x!#lJK$d&*kBFiGRixcbpv@6%g8`?^$f7`yX_IHHCkcb*5_u zX?{3=!e8TNU?Wp-u2F6^{@bN^B__SiY4@USd%4q9Zu(wC;AQU`?caRdWL8@0o;bn{ z_%-v|FX`&7Up4d3gTqHstKyz5={;w+?fu*836PQXA(>}%Atf8&YOmK`N5VfEp08aH zM!i%NLhC*4(^ipH>l@*8HYlCuHyGk{F3OW&`Prz>;jWPjjhU9sF_jzVoBvVapXO!F zb?P#p1O%Sd#17|A8D)mKZN4K>@nY8dE&e6IM<(3_^Y#L z4sq`vO^;bwHO-+$S}!R~k(CvY!ybbzc^A*;+6YI6B3;v+EtKpt!gX&;28to;4;s8a7`ST@V{<#Zu$q2=;DL^jPD6i1{{O2H+dNOCLn zrU}0LAvg9@C*o~mr|vo1VO`01kTtEl5|AB;5T^0vWjQcaSD)%kD=>cb;9q0bgt5se z*><49wV3iJyjSOEbZ0{oiK*F`KSKXyT~3*qxiqwXo#+l5aIQ(B2w8?Zf0v-GfLvwM zw!dK+XUO?I8E7+-ikB)XeV^d!ePUZTUW}{&(LWA9lJY~`@_)(Xq3HA%~%yCi? z)GfXaZCBF{mDyt7F8FmbC1l09&v5q0Pf*|~E}?0xH^uivC$4C*A65>~m7kJ^<99j9 zJC{=mv=z2oQ(;o#W}O<%@wo4S$_AdzSw)F3+@*$-OPFEYsljJ30!O@7(=N#~#GniH5zC0P zoo(gSdl6oa`(3#x>S@PlqPFDl#|pkr7@;qL;a^*&vgSJQ%)(1kI(VWHLq^+0WsYh}qDR>ryf4CFN+w{wA;h^}$S8|haVWWEK> z?*SlH`gFg88_5c*iue7nBmW*Db%ZbGYS6}VsJ`{X*qYAnA2o#1>kakv=bKUB zc9rZ2r)1bhT&SrM-UIHHB!YUJqw_dHTR78ZpKdiV%A}$)a`)K<@Hxd0@^CV7S1GB* zh07EihCgjQMQd!9Tg6dgTja;`Dg;jKn z2r9@1#9d^|j6#_XsC=NeD-ORpOPb_5+(R5~Din@q*?n*K4Zp^$P;l*E9&bW~Omk%* z8nRXqDSq*z8yHp_;5uC{259vw8_g@K1$pebr?}}r95s^M>A@6v<0mfX@7>jh@~dLh1tdJ$bLUC=J&sZ$}joDTUeF652G>8(xcsAGAA-1a1F30HC}7 z)26f%?qeSHT&O&l(U#QtWG+L&$OuOC1kh6j0BA%}g0dUaf3@Q%r4o=m`uyeu+bMZKG%3vFE!*Vv;0=)pR@vu_ktis6 z;0CKbnJBZ^pkvjfSbc(y8Fq+j$GclQb~}I9wevt6GAt4g3Hp+idrpCWnQ>Xp`{PZ7 z$-6cqtply!SncZECbA>DzFwHpc+%A0qdcfHuocQR-UGS}7?B8U8<_Mz%kNYu^3920 z%|N5tg}rB+ONgWa!TlvjxW5Ac7OX&GZ}%SM3+{vAH0X*CtXxl*R%(I4Ni|@C zRK`U3>h8d#>QJ%$ah#oyS8i?LZ|Ul^L?2O)KH*<=oJfi;~)W?}3Fu>yB9B_SwIT-T*~;E3%`3y4BLRP3 zL?2y<_NgX>7~g{8!xP?zE(<+;c}Lmv2zvUtib&q}jp%X{bS&p>ELfD)ys`YaWVJuh z%y70@;&|CWdPKawId;Qpu6YVJG)n*lN=%i~*x%_cLj zI!Xkw#)&$0! ze0%*?+3E?tKMvR`c3Ik!yg7YTm7iYBcP2WC$pwzWd~xtc{vXVkd}y6!feTpG5&i`+ zwdge%_S#Vn2K%V&n7kH4w2sdR9grX@lty#pW~|q(B1E zMT&bBSR+jpZWS2pLw9{hyf)V#b6{Xl{=V*}DqA^-1J$Y6i9m^JS>pT5V~pIbfAnIO zy1|zcrC+k*h7+yg9RF%!t)ixi#Tw?!a87~z`0`jy(NhgZl_Vk;Sv9hMFIihPHQ|ag zXc4l$zZhYfKxuLk`Ci0*$>jPFwxgb{y|`Gt_?XUq8c`Q#*mJHR zsIIubI$=Z3aSIn&f#Ibd`J0yHW-7E)zWGS^v#`SF*qaPnj64|!Pg3D8-^^#7v}v1V zlca@psB3CeU_>&QbU((CMGT>U$Uyk%d)x*2{J?OOBSFVLqrvIeWFhRt4dky6RF`1R zB#T8`zGdT+Eerrlf%cz;zafWHw|8^FA(%-Gw_plV_c_-?5U3Q=_d!~ z8*AJU({?LgZwHVKWoKwOTw0O~me9*@5|xVo8<*X;ChZ(e4&aYq8B%%uz?yfl`hs#; zXFjNA)Na=MTPpg|rrj#i%l0uulE)KNEjDCDhuteQe6^0jv@d-r{;FYT(VncTfhLjM z6>*()$5A`d8v+o@n`)7vxg18uq3nE-y+njCjC86K1(o3) z%HC(R?@r{}?|QozGyL=w+?*tov=u%NPHE$cY=A{b4Y@%>C;rBL-s{um92?{w-s2`u z4seOCTTrK~{6lt6730Uj0de_qP-hR9!3xA4nQ0BGCRfC`Bb=gvMGkvNca!FmU3|&J zYGJUq*?V$n`zmqAYr(uBkC3;?>G>d2Si(*aAtEf0W3) z#&jlPu@BUL@yX0bcWFL_5k^=-AjY+;-W zo$L9tQ|u#Ycj_*2A6SK()ARAZ%#a52WfRHoC&k%yR?jtux0>tD(lok)^W!?uMo81J z=So5engj9Q_>Aj5S0>8&{ws+Ln5Vy}2y2BF&wcKLit4D*9sNQtVyrT5t!kxA5ywY& zkae8Wp``0C7*sgq=dmi|g$`_7;Aib-enRY1Mskr|i1e^(cqp$k2}Dj%{TyOJ{z*LM zt|EY){7uFM&whRYd+qD-p#28YMTOHg_ErB@?%j*|Vr%nXLAzq@^^A1N7JogI_YOHR zn0P^+{ax8y2w?uate}3+jIF%%PO!#DdY<5yx}MruQr7^TkABsp{iAPI5-p4jad4yH zI9+h6sCUE5#92zDz%d8}9{aBrKyBH?^;1iHfNNx8YO02*a{aVod(-&b8bVV@N$6;T zUgdZ^MJi~06xQSSUAuN6oIUoPOJVG;*4R&jO|)!&1W};L$WfiJ#xf z*9jVtNW3HwbX+t>1YJwWAL!;AL=wAwwQ6H}I5exu0u;qdqcW_m&`JM*4oXBeQY z*s=+tUb&Xwf4CSw5}&lWJ!1nm8wGWXUnxh&L_CD-D=gPpDo{+hShtc&Hzc5>!6C$o zD&h@`N549|si(%Qr6stayMe_L|IWcFT0V0Q;{RMgPFbKJGI9n_qNvTt3U1=#>xmtf z0?b^zPezVdCqJduk8*E3Pp5kN!=_08TASJaYJaPgxy;kX_mD!s8{4_}3q5&IiSf}I zbGH!WZXpb+Pm8>(+SOP>Z@lCu}-+n z`N^)efOP2hB7C)tCz=iX z87`u>ocGiE6RT<=UYc?8&O=l0P71rerBL$Tq^OiKnNfm9b%69d|4{a>yplmlkdP+C z%&q7uG~3x#Nb1Xt%M+(OP~GLa7_5cUr8Y6%xk$u845c@sBNKUhqANl6lg$mY$o2Z< zZg2*_*c2N>cl5L686lEh!va&)sgG9 zxS^Mc#25K@)jzd|UR=x}$T~nGL!A`P^*isWsE6z}J)yLUUnBW0;@`t%rUrtnHY^vY zT<@P$Pnr4Lv$=wWH^M2W4a;dBNt?ZDHJOxgp6j z$F`Odu3r9=lsvrpq4A6>FNvAzz+|r7-bk|ojCCR_Q_m|qPHi5qQ7q@bx*B0@ z3dvR89hC8WUx(8)BF;4y_jIb=;StnZlRyQ@=isDI$vmMKCb%9&7idcunpX6ItFNR@ z0RCyOGLo}etq1ijf$axr2&* z%NCdZ&8c7=nH%r%<=m%Hg+duNi+GBO>1N&W9`ZwLMluTdcW2463M+Om71Z(VFgD+E;6VZQ7dY$Z@A_Rl620S`@=`OfSJ?4cVtv7M1im{NveDbY3 z$rcFXy9tCO}z|4AOR$_cn$MB;@ad_P#sfXw(u^7rV_$fXCBr?S@EMjPGJucNMW#YFP~mTvVr@) zVxOvovg^yyxg1_%@QkZ@$wB?#!=yVT;_ce_`^uX@dBFuqX^VOToLqt7(O9VQcd>Yv zAqG{XDVB~K=D>RDDW^)kQDQcxP&|JNQ4vAJ*6exJo}KO(O`yEZh{ z#p!$#Mp!v`)0a zRIP>c9Jh0w@EL$b&jF8x7O9^_?6!$sCnhI&Hh{!R5@CKB#ulbQhW!(efEdD`&$i>6 z7V$gD1H0UZSG5QbUCH*IDIafUAD!9Q5&@7vHNMd&ih3n{t{RMCklZVgR>^Xky0-QO zaS_G#BIMgNnKIdGl2K^5f}MwpL&L=rCZfsGBXH!8AYLOe~%J}e4=RYw#o v+LRnq2hC4){=e4v{a?u?Q1?a;dcc#eYHs(xX8R2kK7usWbRpF$ucH1Rc(6Bn diff --git a/assets/slackreport.json b/assets/slackreport.json index 043d02f2..bd9523d9 100644 --- a/assets/slackreport.json +++ b/assets/slackreport.json @@ -3,7 +3,7 @@ { "fallback": "Plain-text summary of the attachment.", "color": "<% if (success) { %>good<% } else { %>danger<%} %>", - "author_name": "sanger-tol/readmapping v${version} - ${runName}", + "author_name": "nf-core/airrflow v${version} - ${runName}", "author_icon": "https://www.nextflow.io/docs/latest/_static/favicon.ico", "text": "<% if (success) { %>Pipeline completed successfully!<% } else { %>Pipeline completed with errors<% } %>", "fields": [ diff --git a/conf/test_full.config b/conf/test_full.config index ff79f3e2..9c410f35 100644 --- a/conf/test_full.config +++ b/conf/test_full.config @@ -10,8 +10,6 @@ ---------------------------------------------------------------------------------------- */ -cleanup = true - params { config_profile_name = 'Full test profile' config_profile_description = 'Full test dataset to check pipeline function' diff --git a/docs/usage.md b/docs/usage.md index b947ea51..1f49c7a7 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -57,7 +57,7 @@ An [example samplesheet](../assets/samplesheet.csv) has been provided with the p The typical command for running the pipeline is as follows: ```bash -nextflow run nf-core/airrflow --input samplesheet.csv --outdir --genome GRCh37 -profile docker +nextflow run nf-core/airrflow --input ./samplesheet.csv --outdir ./results --genome GRCh37 -profile docker ``` This will launch the pipeline with the `docker` configuration profile. See below for more information about profiles. @@ -76,7 +76,8 @@ If you wish to repeatedly use the same parameters for multiple runs, rather than Pipeline settings can be provided in a `yaml` or `json` file via `-params-file `. > ⚠️ Do not use `-c ` to specify parameters as this will result in errors. Custom config files specified with `-c` must only be used for [tuning process resource specifications](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources), other infrastructural tweaks (such as output directories), or module arguments (args). -> The above pipeline run specified with a params file in yaml format: + +The above pipeline run specified with a params file in yaml format: ```bash nextflow run nf-core/airrflow -profile docker -params-file params.yaml @@ -88,7 +89,6 @@ with `params.yaml` containing: input: './samplesheet.csv' outdir: './results/' genome: 'GRCh37' -input: 'data' <...> ``` diff --git a/lib/NfcoreSchema.groovy b/lib/NfcoreSchema.groovy deleted file mode 100755 index 9b34804d..00000000 --- a/lib/NfcoreSchema.groovy +++ /dev/null @@ -1,530 +0,0 @@ -// -// This file holds several functions used to perform JSON parameter validation, help and summary rendering for the nf-core pipeline template. -// - -import nextflow.Nextflow -import org.everit.json.schema.Schema -import org.everit.json.schema.loader.SchemaLoader -import org.everit.json.schema.ValidationException -import org.json.JSONObject -import org.json.JSONTokener -import org.json.JSONArray -import groovy.json.JsonSlurper -import groovy.json.JsonBuilder - -class NfcoreSchema { - - // - // Resolve Schema path relative to main workflow directory - // - public static String getSchemaPath(workflow, schema_filename='nextflow_schema.json') { - return "${workflow.projectDir}/${schema_filename}" - } - - // - // Function to loop over all parameters defined in schema and check - // whether the given parameters adhere to the specifications - // - /* groovylint-disable-next-line UnusedPrivateMethodParameter */ - public static void validateParameters(workflow, params, log, schema_filename='nextflow_schema.json') { - def has_error = false - //~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~// - // Check for nextflow core params and unexpected params - def json = new File(getSchemaPath(workflow, schema_filename=schema_filename)).text - def Map schemaParams = (Map) new JsonSlurper().parseText(json).get('definitions') - def nf_params = [ - // Options for base `nextflow` command - 'bg', - 'c', - 'C', - 'config', - 'd', - 'D', - 'dockerize', - 'h', - 'log', - 'q', - 'quiet', - 'syslog', - 'v', - - // Options for `nextflow run` command - 'ansi', - 'ansi-log', - 'bg', - 'bucket-dir', - 'c', - 'cache', - 'config', - 'dsl2', - 'dump-channels', - 'dump-hashes', - 'E', - 'entry', - 'latest', - 'lib', - 'main-script', - 'N', - 'name', - 'offline', - 'params-file', - 'pi', - 'plugins', - 'poll-interval', - 'pool-size', - 'profile', - 'ps', - 'qs', - 'queue-size', - 'r', - 'resume', - 'revision', - 'stdin', - 'stub', - 'stub-run', - 'test', - 'w', - 'with-apptainer', - 'with-charliecloud', - 'with-conda', - 'with-dag', - 'with-docker', - 'with-mpi', - 'with-notification', - 'with-podman', - 'with-report', - 'with-singularity', - 'with-timeline', - 'with-tower', - 'with-trace', - 'with-weblog', - 'without-docker', - 'without-podman', - 'work-dir' - ] - def unexpectedParams = [] - - // Collect expected parameters from the schema - def expectedParams = [] - def enums = [:] - for (group in schemaParams) { - for (p in group.value['properties']) { - expectedParams.push(p.key) - if (group.value['properties'][p.key].containsKey('enum')) { - enums[p.key] = group.value['properties'][p.key]['enum'] - } - } - } - - for (specifiedParam in params.keySet()) { - // nextflow params - if (nf_params.contains(specifiedParam)) { - log.error "ERROR: You used a core Nextflow option with two hyphens: '--${specifiedParam}'. Please resubmit with '-${specifiedParam}'" - has_error = true - } - // unexpected params - def params_ignore = params.schema_ignore_params.split(',') + 'schema_ignore_params' - def expectedParamsLowerCase = expectedParams.collect{ it.replace("-", "").toLowerCase() } - def specifiedParamLowerCase = specifiedParam.replace("-", "").toLowerCase() - def isCamelCaseBug = (specifiedParam.contains("-") && !expectedParams.contains(specifiedParam) && expectedParamsLowerCase.contains(specifiedParamLowerCase)) - if (!expectedParams.contains(specifiedParam) && !params_ignore.contains(specifiedParam) && !isCamelCaseBug) { - // Temporarily remove camelCase/camel-case params #1035 - def unexpectedParamsLowerCase = unexpectedParams.collect{ it.replace("-", "").toLowerCase()} - if (!unexpectedParamsLowerCase.contains(specifiedParamLowerCase)){ - unexpectedParams.push(specifiedParam) - } - } - } - - //~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~// - // Validate parameters against the schema - InputStream input_stream = new File(getSchemaPath(workflow, schema_filename=schema_filename)).newInputStream() - JSONObject raw_schema = new JSONObject(new JSONTokener(input_stream)) - - // Remove anything that's in params.schema_ignore_params - raw_schema = removeIgnoredParams(raw_schema, params) - - Schema schema = SchemaLoader.load(raw_schema) - - // Clean the parameters - def cleanedParams = cleanParameters(params) - - // Convert to JSONObject - def jsonParams = new JsonBuilder(cleanedParams) - JSONObject params_json = new JSONObject(jsonParams.toString()) - - // Validate - try { - schema.validate(params_json) - } catch (ValidationException e) { - println '' - log.error 'ERROR: Validation of pipeline parameters failed!' - JSONObject exceptionJSON = e.toJSON() - printExceptions(exceptionJSON, params_json, log, enums) - println '' - has_error = true - } - - // Check for unexpected parameters - if (unexpectedParams.size() > 0) { - Map colors = NfcoreTemplate.logColours(params.monochrome_logs) - println '' - def warn_msg = 'Found unexpected parameters:' - for (unexpectedParam in unexpectedParams) { - warn_msg = warn_msg + "\n* --${unexpectedParam}: ${params[unexpectedParam].toString()}" - } - log.warn warn_msg - log.info "- ${colors.dim}Ignore this warning: params.schema_ignore_params = \"${unexpectedParams.join(',')}\" ${colors.reset}" - println '' - } - - if (has_error) { - Nextflow.error('Exiting!') - } - } - - // - // Beautify parameters for --help - // - public static String paramsHelp(workflow, params, command, schema_filename='nextflow_schema.json') { - Map colors = NfcoreTemplate.logColours(params.monochrome_logs) - Integer num_hidden = 0 - String output = '' - output += 'Typical pipeline command:\n\n' - output += " ${colors.cyan}${command}${colors.reset}\n\n" - Map params_map = paramsLoad(getSchemaPath(workflow, schema_filename=schema_filename)) - Integer max_chars = paramsMaxChars(params_map) + 1 - Integer desc_indent = max_chars + 14 - Integer dec_linewidth = 160 - desc_indent - for (group in params_map.keySet()) { - Integer num_params = 0 - String group_output = colors.underlined + colors.bold + group + colors.reset + '\n' - def group_params = params_map.get(group) // This gets the parameters of that particular group - for (param in group_params.keySet()) { - if (group_params.get(param).hidden && !params.show_hidden_params) { - num_hidden += 1 - continue; - } - def type = '[' + group_params.get(param).type + ']' - def description = group_params.get(param).description - def defaultValue = group_params.get(param).default != null ? " [default: " + group_params.get(param).default.toString() + "]" : '' - def description_default = description + colors.dim + defaultValue + colors.reset - // Wrap long description texts - // Loosely based on https://dzone.com/articles/groovy-plain-text-word-wrap - if (description_default.length() > dec_linewidth){ - List olines = [] - String oline = "" // " " * indent - description_default.split(" ").each() { wrd -> - if ((oline.size() + wrd.size()) <= dec_linewidth) { - oline += wrd + " " - } else { - olines += oline - oline = wrd + " " - } - } - olines += oline - description_default = olines.join("\n" + " " * desc_indent) - } - group_output += " --" + param.padRight(max_chars) + colors.dim + type.padRight(10) + colors.reset + description_default + '\n' - num_params += 1 - } - group_output += '\n' - if (num_params > 0){ - output += group_output - } - } - if (num_hidden > 0){ - output += colors.dim + "!! Hiding $num_hidden params, use --show_hidden_params to show them !!\n" + colors.reset - } - output += NfcoreTemplate.dashedLine(params.monochrome_logs) - return output - } - - // - // Groovy Map summarising parameters/workflow options used by the pipeline - // - public static LinkedHashMap paramsSummaryMap(workflow, params, schema_filename='nextflow_schema.json') { - // Get a selection of core Nextflow workflow options - def Map workflow_summary = [:] - if (workflow.revision) { - workflow_summary['revision'] = workflow.revision - } - workflow_summary['runName'] = workflow.runName - if (workflow.containerEngine) { - workflow_summary['containerEngine'] = workflow.containerEngine - } - if (workflow.container) { - workflow_summary['container'] = workflow.container - } - workflow_summary['launchDir'] = workflow.launchDir - workflow_summary['workDir'] = workflow.workDir - workflow_summary['projectDir'] = workflow.projectDir - workflow_summary['userName'] = workflow.userName - workflow_summary['profile'] = workflow.profile - workflow_summary['configFiles'] = workflow.configFiles.join(', ') - - // Get pipeline parameters defined in JSON Schema - def Map params_summary = [:] - def params_map = paramsLoad(getSchemaPath(workflow, schema_filename=schema_filename)) - for (group in params_map.keySet()) { - def sub_params = new LinkedHashMap() - def group_params = params_map.get(group) // This gets the parameters of that particular group - for (param in group_params.keySet()) { - if (params.containsKey(param)) { - def params_value = params.get(param) - def schema_value = group_params.get(param).default - def param_type = group_params.get(param).type - if (schema_value != null) { - if (param_type == 'string') { - if (schema_value.contains('$projectDir') || schema_value.contains('${projectDir}')) { - def sub_string = schema_value.replace('\$projectDir', '') - sub_string = sub_string.replace('\${projectDir}', '') - if (params_value.contains(sub_string)) { - schema_value = params_value - } - } - if (schema_value.contains('$params.outdir') || schema_value.contains('${params.outdir}')) { - def sub_string = schema_value.replace('\$params.outdir', '') - sub_string = sub_string.replace('\${params.outdir}', '') - if ("${params.outdir}${sub_string}" == params_value) { - schema_value = params_value - } - } - } - } - - // We have a default in the schema, and this isn't it - if (schema_value != null && params_value != schema_value) { - sub_params.put(param, params_value) - } - // No default in the schema, and this isn't empty - else if (schema_value == null && params_value != "" && params_value != null && params_value != false) { - sub_params.put(param, params_value) - } - } - } - params_summary.put(group, sub_params) - } - return [ 'Core Nextflow options' : workflow_summary ] << params_summary - } - - // - // Beautify parameters for summary and return as string - // - public static String paramsSummaryLog(workflow, params) { - Map colors = NfcoreTemplate.logColours(params.monochrome_logs) - String output = '' - def params_map = paramsSummaryMap(workflow, params) - def max_chars = paramsMaxChars(params_map) - for (group in params_map.keySet()) { - def group_params = params_map.get(group) // This gets the parameters of that particular group - if (group_params) { - output += colors.bold + group + colors.reset + '\n' - for (param in group_params.keySet()) { - output += " " + colors.blue + param.padRight(max_chars) + ": " + colors.green + group_params.get(param) + colors.reset + '\n' - } - output += '\n' - } - } - output += "!! Only displaying parameters that differ from the pipeline defaults !!\n" - output += NfcoreTemplate.dashedLine(params.monochrome_logs) - return output - } - - // - // Loop over nested exceptions and print the causingException - // - private static void printExceptions(ex_json, params_json, log, enums, limit=5) { - def causingExceptions = ex_json['causingExceptions'] - if (causingExceptions.length() == 0) { - def m = ex_json['message'] =~ /required key \[([^\]]+)\] not found/ - // Missing required param - if (m.matches()) { - log.error "* Missing required parameter: --${m[0][1]}" - } - // Other base-level error - else if (ex_json['pointerToViolation'] == '#') { - log.error "* ${ex_json['message']}" - } - // Error with specific param - else { - def param = ex_json['pointerToViolation'] - ~/^#\// - def param_val = params_json[param].toString() - if (enums.containsKey(param)) { - def error_msg = "* --${param}: '${param_val}' is not a valid choice (Available choices" - if (enums[param].size() > limit) { - log.error "${error_msg} (${limit} of ${enums[param].size()}): ${enums[param][0..limit-1].join(', ')}, ... )" - } else { - log.error "${error_msg}: ${enums[param].join(', ')})" - } - } else { - log.error "* --${param}: ${ex_json['message']} (${param_val})" - } - } - } - for (ex in causingExceptions) { - printExceptions(ex, params_json, log, enums) - } - } - - // - // Remove an element from a JSONArray - // - private static JSONArray removeElement(json_array, element) { - def list = [] - int len = json_array.length() - for (int i=0;i - if(raw_schema.keySet().contains('definitions')){ - raw_schema.definitions.each { definition -> - for (key in definition.keySet()){ - if (definition[key].get("properties").keySet().contains(ignore_param)){ - // Remove the param to ignore - definition[key].get("properties").remove(ignore_param) - // If the param was required, change this - if (definition[key].has("required")) { - def cleaned_required = removeElement(definition[key].required, ignore_param) - definition[key].put("required", cleaned_required) - } - } - } - } - } - if(raw_schema.keySet().contains('properties') && raw_schema.get('properties').keySet().contains(ignore_param)) { - raw_schema.get("properties").remove(ignore_param) - } - if(raw_schema.keySet().contains('required') && raw_schema.required.contains(ignore_param)) { - def cleaned_required = removeElement(raw_schema.required, ignore_param) - raw_schema.put("required", cleaned_required) - } - } - return raw_schema - } - - // - // Clean and check parameters relative to Nextflow native classes - // - private static Map cleanParameters(params) { - def new_params = params.getClass().newInstance(params) - for (p in params) { - // remove anything evaluating to false - if (!p['value']) { - new_params.remove(p.key) - } - // Cast MemoryUnit to String - if (p['value'].getClass() == nextflow.util.MemoryUnit) { - new_params.replace(p.key, p['value'].toString()) - } - // Cast Duration to String - if (p['value'].getClass() == nextflow.util.Duration) { - new_params.replace(p.key, p['value'].toString().replaceFirst(/d(?!\S)/, "day")) - } - // Cast LinkedHashMap to String - if (p['value'].getClass() == LinkedHashMap) { - new_params.replace(p.key, p['value'].toString()) - } - } - return new_params - } - - // - // This function tries to read a JSON params file - // - private static LinkedHashMap paramsLoad(String json_schema) { - def params_map = new LinkedHashMap() - try { - params_map = paramsRead(json_schema) - } catch (Exception e) { - println "Could not read parameters settings from JSON. $e" - params_map = new LinkedHashMap() - } - return params_map - } - - // - // Method to actually read in JSON file using Groovy. - // Group (as Key), values are all parameters - // - Parameter1 as Key, Description as Value - // - Parameter2 as Key, Description as Value - // .... - // Group - // - - private static LinkedHashMap paramsRead(String json_schema) throws Exception { - def json = new File(json_schema).text - def Map schema_definitions = (Map) new JsonSlurper().parseText(json).get('definitions') - def Map schema_properties = (Map) new JsonSlurper().parseText(json).get('properties') - /* Tree looks like this in nf-core schema - * definitions <- this is what the first get('definitions') gets us - group 1 - title - description - properties - parameter 1 - type - description - parameter 2 - type - description - group 2 - title - description - properties - parameter 1 - type - description - * properties <- parameters can also be ungrouped, outside of definitions - parameter 1 - type - description - */ - - // Grouped params - def params_map = new LinkedHashMap() - schema_definitions.each { key, val -> - def Map group = schema_definitions."$key".properties // Gets the property object of the group - def title = schema_definitions."$key".title - def sub_params = new LinkedHashMap() - group.each { innerkey, value -> - sub_params.put(innerkey, value) - } - params_map.put(title, sub_params) - } - - // Ungrouped params - def ungrouped_params = new LinkedHashMap() - schema_properties.each { innerkey, value -> - ungrouped_params.put(innerkey, value) - } - params_map.put("Other parameters", ungrouped_params) - - return params_map - } - - // - // Get maximum number of characters across all parameter names - // - private static Integer paramsMaxChars(params_map) { - Integer max_chars = 0 - for (group in params_map.keySet()) { - def group_params = params_map.get(group) // This gets the parameters of that particular group - for (param in group_params.keySet()) { - if (param.size() > max_chars) { - max_chars = param.size() - } - } - } - return max_chars - } -} diff --git a/lib/NfcoreTemplate.groovy b/lib/NfcoreTemplate.groovy index 25a0a74a..408951ae 100755 --- a/lib/NfcoreTemplate.groovy +++ b/lib/NfcoreTemplate.groovy @@ -128,7 +128,7 @@ class NfcoreTemplate { def email_html = html_template.toString() // Render the sendmail template - def max_multiqc_email_size = params.max_multiqc_email_size as nextflow.util.MemoryUnit + def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "$projectDir", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] def sf = new File("$projectDir/assets/sendmail_template.txt") def sendmail_template = engine.createTemplate(sf).make(smail_fields) diff --git a/lib/WorkflowAirrflow.groovy b/lib/WorkflowAirrflow.groovy index ac4d4892..1a4ed820 100755 --- a/lib/WorkflowAirrflow.groovy +++ b/lib/WorkflowAirrflow.groovy @@ -11,6 +11,7 @@ class WorkflowAirrflow { // Check and validate parameters // public static void initialise(params, log) { + genomeExistsError(params, log) @@ -46,15 +47,57 @@ class WorkflowAirrflow { return yaml_file_text } - public static String methodsDescriptionText(run_workflow, mqc_methods_yaml) { + // + // Generate methods description for MultiQC + // + + public static String toolCitationText(params) { + + // TODO Optionally add in-text citation tools to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "Tool (Foo et al. 2023)" : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def citation_text = [ + "Tools used in the workflow included:", + "FastQC (Andrews 2010),", + "MultiQC (Ewels et al. 2016)", + "." + ].join(' ').trim() + + return citation_text + } + + public static String toolBibliographyText(params) { + + // TODO Optionally add bibliographic entries to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "

  • Author (2023) Pub name, Journal, DOI
    • " : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def reference_text = [ + "
  • Andrews S, (2010) FastQC, URL: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
    • ", + "
  • Ewels, P., Magnusson, M., Lundin, S., & Käller, M. (2016). MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics , 32(19), 3047–3048. doi: /10.1093/bioinformatics/btw354
    • " + ].join(' ').trim() + + return reference_text + } + + public static String methodsDescriptionText(run_workflow, mqc_methods_yaml, params) { // Convert to a named map so can be used as with familar NXF ${workflow} variable syntax in the MultiQC YML file def meta = [:] meta.workflow = run_workflow.toMap() meta["manifest_map"] = run_workflow.manifest.toMap() + // Pipeline DOI meta["doi_text"] = meta.manifest_map.doi ? "(doi: ${meta.manifest_map.doi})" : "" meta["nodoi_text"] = meta.manifest_map.doi ? "": "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
    • " + // Tool references + meta["tool_citations"] = "" + meta["tool_bibliography"] = "" + + // TODO Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled! + //meta["tool_citations"] = toolCitationText(params).replaceAll(", \\.", ".").replaceAll("\\. \\.", ".").replaceAll(", \\.", ".") + //meta["tool_bibliography"] = toolBibliographyText(params) + + def methods_text = mqc_methods_yaml.text def engine = new SimpleTemplateEngine() diff --git a/lib/WorkflowMain.groovy b/lib/WorkflowMain.groovy index 93af2d9e..66a2c83c 100755 --- a/lib/WorkflowMain.groovy +++ b/lib/WorkflowMain.groovy @@ -20,40 +20,11 @@ class WorkflowMain { " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" } - // - // Generate help string - // - public static String help(workflow, params) { - def command = "nextflow run ${workflow.manifest.name} --input samplesheet.csv --genome GRCh37 -profile docker" - def help_string = '' - help_string += NfcoreTemplate.logo(workflow, params.monochrome_logs) - help_string += NfcoreSchema.paramsHelp(workflow, params, command) - help_string += '\n' + citation(workflow) + '\n' - help_string += NfcoreTemplate.dashedLine(params.monochrome_logs) - return help_string - } - - // - // Generate parameter summary log string - // - public static String paramsSummaryLog(workflow, params) { - def summary_log = '' - summary_log += NfcoreTemplate.logo(workflow, params.monochrome_logs) - summary_log += NfcoreSchema.paramsSummaryLog(workflow, params) - summary_log += '\n' + citation(workflow) + '\n' - summary_log += NfcoreTemplate.dashedLine(params.monochrome_logs) - return summary_log - } // // Validate parameters and print summary to screen // public static void initialise(workflow, params, log) { - // Print help to screen if required - if (params.help) { - log.info help(workflow, params) - System.exit(0) - } // Print workflow version and exit on --version if (params.version) { @@ -62,14 +33,6 @@ class WorkflowMain { System.exit(0) } - // Print parameter summary log to screen - log.info paramsSummaryLog(workflow, params) - - // Validate workflow parameters via the JSON schema - if (params.validate_params) { - NfcoreSchema.validateParameters(workflow, params, log) - } - // Check that a -profile or Nextflow config has been provided to run the pipeline NfcoreTemplate.checkConfigProvided(workflow, log) diff --git a/main.nf b/main.nf index f64d452c..a999695c 100644 --- a/main.nf +++ b/main.nf @@ -25,6 +25,22 @@ params.fasta = WorkflowMain.getGenomeAttribute(params, 'fasta') ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ +include { validateParameters; paramsHelp } from 'plugin/nf-validation' + +// Print help message if needed +if (params.help) { + def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) + def citation = '\n' + WorkflowMain.citation(workflow) + '\n' + def String command = "nextflow run ${workflow.manifest.name} --input samplesheet.csv --genome GRCh37 -profile docker" + log.info logo + paramsHelp(command) + citation + NfcoreTemplate.dashedLine(params.monochrome_logs) + System.exit(0) +} + +// Validate input parameters +if (params.validate_params) { + validateParameters() +} + WorkflowMain.initialise(workflow, params, log) /* diff --git a/nextflow.config b/nextflow.config index f2b13c12..6332ca41 100644 --- a/nextflow.config +++ b/nextflow.config @@ -12,12 +12,12 @@ params { // TODO nf-core: Specify your pipeline's command line flags // Input options input = null - - // References genome = null igenomes_base = 's3://ngi-igenomes/igenomes' igenomes_ignore = false + + // MultiQC options multiqc_config = null multiqc_title = null @@ -27,7 +27,6 @@ params { // Boilerplate options outdir = null - tracedir = "${params.outdir}/pipeline_info" publish_dir_mode = 'copy' email = null email_on_fail = null @@ -36,19 +35,15 @@ params { hook_url = null help = false version = false - validate_params = true - show_hidden_params = false - schema_ignore_params = 'genomes' - // Config options + config_profile_name = null + config_profile_description = null custom_config_version = 'master' custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" - config_profile_description = null config_profile_contact = null config_profile_url = null - config_profile_name = null - + // Max resource options // Defaults only, expecting to be overwritten @@ -56,6 +51,13 @@ params { max_cpus = 16 max_time = '240.h' + // Schema validation default options + validationFailUnrecognisedParams = false + validationLenientMode = false + validationSchemaIgnoreParams = 'genomes' + validationShowHiddenParams = false + validate_params = true + } // Load base.config by default for all pipelines @@ -75,13 +77,11 @@ try { // } catch (Exception e) { // System.err.println("WARNING: Could not load nf-core/config/airrflow profiles: ${params.custom_config_base}/pipeline/airrflow.config") // } - - profiles { debug { dumpHashes = true process.beforeScript = 'echo $HOSTNAME' - cleanup = false + cleanup = false } conda { conda.enabled = true @@ -104,7 +104,6 @@ profiles { } docker { docker.enabled = true - docker.registry = 'quay.io' docker.userEmulation = true conda.enabled = false singularity.enabled = false @@ -128,7 +127,6 @@ profiles { } podman { podman.enabled = true - podman.registry = 'quay.io' conda.enabled = false docker.enabled = false singularity.enabled = false @@ -172,6 +170,18 @@ profiles { test_full { includeConfig 'conf/test_full.config' } } +// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile +// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled +// Set to your registry if you have a mirror of containers +apptainer.registry = 'quay.io' +docker.registry = 'quay.io' +podman.registry = 'quay.io' +singularity.registry = 'quay.io' + +// Nextflow plugins +plugins { + id 'nf-validation' // Validation of pipeline parameters and creation of an input channel from a sample sheet +} // Load igenomes.config if required if (!params.igenomes_ignore) { @@ -179,8 +189,6 @@ if (!params.igenomes_ignore) { } else { params.genomes = [:] } - - // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. // See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable. @@ -198,19 +206,19 @@ process.shell = ['/bin/bash', '-euo', 'pipefail'] def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') timeline { enabled = true - file = "${params.tracedir}/execution_timeline_${trace_timestamp}.html" + file = "${params.outdir}/pipeline_info/execution_timeline_${trace_timestamp}.html" } report { enabled = true - file = "${params.tracedir}/execution_report_${trace_timestamp}.html" + file = "${params.outdir}/pipeline_info/execution_report_${trace_timestamp}.html" } trace { enabled = true - file = "${params.tracedir}/execution_trace_${trace_timestamp}.txt" + file = "${params.outdir}/pipeline_info/execution_trace_${trace_timestamp}.txt" } dag { enabled = true - file = "${params.tracedir}/pipeline_dag_${trace_timestamp}.html" + file = "${params.outdir}/pipeline_info/pipeline_dag_${trace_timestamp}.html" } manifest { @@ -219,8 +227,8 @@ manifest { homePage = 'https://github.com/nf-core/airrflow' description = """B and T cell repertoire analysis pipeline with the Immcantation framework.""" mainScript = 'main.nf' - nextflowVersion = '!>=22.10.1' - version = '3.0' + nextflowVersion = '!>=23.04.0' + version = '3.1.0' doi = '' } diff --git a/nextflow_schema.json b/nextflow_schema.json index 9e272c13..1225d229 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -15,9 +15,9 @@ "input": { "type": "string", "format": "file-path", + "exists": true, "mimetype": "text/csv", "pattern": "^\\S+\\.csv$", - "schema": "assets/schema_input.json", "description": "Path to comma-separated file containing information about the samples in the experiment.", "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See [usage docs](https://nf-co.re/airrflow/usage#samplesheet-input).", "fa_icon": "fas fa-file-csv" @@ -57,6 +57,7 @@ "fasta": { "type": "string", "format": "file-path", + "exists": true, "mimetype": "text/plain", "pattern": "^\\S+\\.fn?a(sta)?(\\.gz)?$", "description": "Path to FASTA genome file.", @@ -157,7 +158,7 @@ "description": "Maximum amount of time that can be requested for any single job.", "default": "240.h", "fa_icon": "far fa-clock", - "pattern": "^(\\d+\\.?\\s*(s|m|h|day)\\s*)+$", + "pattern": "^(\\d+\\.?\\s*(s|m|h|d|day)\\s*)+$", "hidden": true, "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`" } @@ -174,12 +175,14 @@ "type": "boolean", "description": "Display help text.", "fa_icon": "fas fa-question-circle", + "default": false, "hidden": true }, "version": { "type": "boolean", "description": "Display version and exit.", "fa_icon": "fas fa-question-circle", + "default": false, "hidden": true }, "publish_dir_mode": { @@ -203,6 +206,7 @@ "type": "boolean", "description": "Send plain-text email instead of HTML.", "fa_icon": "fas fa-remove-format", + "default": false, "hidden": true }, "max_multiqc_email_size": { @@ -217,6 +221,7 @@ "type": "boolean", "description": "Do not use coloured log outputs.", "fa_icon": "fas fa-palette", + "default": false, "hidden": true }, "hook_url": { @@ -228,6 +233,7 @@ }, "multiqc_config": { "type": "string", + "format": "file-path", "description": "Custom config file to supply to MultiQC.", "fa_icon": "fas fa-cog", "hidden": true @@ -243,13 +249,6 @@ "description": "Custom MultiQC yaml file containing HTML including a methods description.", "fa_icon": "fas fa-cog" }, - "tracedir": { - "type": "string", - "description": "Directory to keep pipeline Nextflow logs and reports.", - "default": "${params.outdir}/pipeline_info", - "fa_icon": "fas fa-cogs", - "hidden": true - }, "validate_params": { "type": "boolean", "description": "Boolean whether to validate parameters against the schema at runtime", @@ -257,12 +256,29 @@ "fa_icon": "fas fa-check-square", "hidden": true }, - "show_hidden_params": { + "validationShowHiddenParams": { "type": "boolean", "fa_icon": "far fa-eye-slash", "description": "Show all params when using `--help`", + "default": false, "hidden": true, "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters." + }, + "validationFailUnrecognisedParams": { + "type": "boolean", + "fa_icon": "far fa-check-circle", + "description": "Validation of parameters fails when an unrecognised parameter is found.", + "default": false, + "hidden": true, + "help_text": "By default, when an unrecognised parameter is found, it returns a warinig." + }, + "validationLenientMode": { + "type": "boolean", + "fa_icon": "far fa-check-circle", + "description": "Validation of parameters in lenient more.", + "default": false, + "hidden": true, + "help_text": "Allows string values that are parseable as numbers or booleans. For further information see [JSONSchema docs](https://github.com/everit-org/json-schema#lenient-mode)." } } } diff --git a/workflows/airrflow.nf b/workflows/airrflow.nf index b1ed19c4..b71b315e 100644 --- a/workflows/airrflow.nf +++ b/workflows/airrflow.nf @@ -1,21 +1,19 @@ /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - VALIDATE INPUTS + PRINT PARAMS SUMMARY ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -def summary_params = NfcoreSchema.paramsSummaryMap(workflow, params) +include { paramsSummaryLog; paramsSummaryMap } from 'plugin/nf-validation' -// Validate input parameters -WorkflowAirrflow.initialise(params, log) +def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) +def citation = '\n' + WorkflowMain.citation(workflow) + '\n' +def summary_params = paramsSummaryMap(workflow) -// TODO nf-core: Add all file path parameters for the pipeline to the list below -// Check input path parameters to see if they exist -def checkPathParamList = [ params.input, params.multiqc_config, params.fasta ] -for (param in checkPathParamList) { if (param) { file(param, checkIfExists: true) } } +// Print parameter summary log to screen +log.info logo + paramsSummaryLog(workflow) + citation -// Check mandatory parameters -if (params.input) { ch_input = file(params.input) } else { exit 1, 'Input samplesheet not specified!' } +WorkflowAirrflow.initialise(params, log) /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -69,9 +67,12 @@ workflow AIRRFLOW { // SUBWORKFLOW: Read in samplesheet, validate and stage input files // INPUT_CHECK ( - ch_input + file(params.input) ) ch_versions = ch_versions.mix(INPUT_CHECK.out.versions) + // TODO: OPTIONAL, you can use nf-validation plugin to create an input channel from the samplesheet with Channel.fromSamplesheet("input") + // See the documentation https://nextflow-io.github.io/nf-validation/samplesheets/fromSamplesheet/ + // ! There is currently no tooling to help you write a sample sheet schema // // MODULE: Run FastQC @@ -91,7 +92,7 @@ workflow AIRRFLOW { workflow_summary = WorkflowAirrflow.paramsSummaryMultiqc(workflow, summary_params) ch_workflow_summary = Channel.value(workflow_summary) - methods_description = WorkflowAirrflow.methodsDescriptionText(workflow, ch_multiqc_custom_methods_description) + methods_description = WorkflowAirrflow.methodsDescriptionText(workflow, ch_multiqc_custom_methods_description, params) ch_methods_description = Channel.value(methods_description) ch_multiqc_files = Channel.empty() From 6963132aa835fbc6a2536cbd1d3a5e5dbddb01a3 Mon Sep 17 00:00:00 2001 From: Matt De Both Date: Thu, 6 Jul 2023 12:22:30 -0700 Subject: [PATCH 038/111] Fixed imgt download url --- bin/fetch_imgt.sh | 18 +++++++++--------- 1 file changed, 9 insertions(+), 9 deletions(-) diff --git a/bin/fetch_imgt.sh b/bin/fetch_imgt.sh index a7780d49..7803a92e 100755 --- a/bin/fetch_imgt.sh +++ b/bin/fetch_imgt.sh @@ -68,7 +68,7 @@ do echo "|---- Ig" for CHAIN in IGHV IGHD IGHJ IGKV IGKJ IGLV IGLJ do - URL="http://www.imgt.org/IMGT_GENE-DB/GENElect?query=7.14+${CHAIN}&species=${VALUE}" + URL="https://www.imgt.org/genedb/GENElect?query=7.14+${CHAIN}&species=${VALUE}" FILE_NAME="${FILE_PATH}/${REPERTOIRE}_${KEY}_${CHAIN}.fasta" TMP_FILE="${FILE_NAME}.tmp" #echo $URL @@ -93,7 +93,7 @@ do # V amino acid for Ig for CHAIN in IGHV IGKV IGLV do - URL="http://www.imgt.org/IMGT_GENE-DB/GENElect?query=7.3+${CHAIN}&species=${VALUE}" + URL="https://www.imgt.org/genedb/GENElect?query=7.3+${CHAIN}&species=${VALUE}" FILE_NAME="${FILE_PATH_AA}/${REPERTOIRE}_aa_${KEY}_${CHAIN}.fasta" TMP_FILE="${FILE_NAME}.tmp" #echo $URL @@ -108,7 +108,7 @@ do echo "|---- TCR" for CHAIN in TRAV TRAJ TRBV TRBD TRBJ TRDV TRDD TRDJ TRGV TRGJ do - URL="http://www.imgt.org/IMGT_GENE-DB/GENElect?query=7.14+${CHAIN}&species=${VALUE}" + URL="https://www.imgt.org/genedb/GENElect?query=7.14+${CHAIN}&species=${VALUE}" FILE_NAME="${FILE_PATH}/${REPERTOIRE}_${KEY}_${CHAIN}.fasta" TMP_FILE="${FILE_NAME}.tmp" #echo $URL @@ -121,7 +121,7 @@ do # V amino acid for TCR for CHAIN in TRAV TRBV TRDV TRGV do - URL="http://www.imgt.org/IMGT_GENE-DB/GENElect?query=7.3+${CHAIN}&species=${VALUE}" + URL="https://www.imgt.org/genedb/GENElect?query=7.3+${CHAIN}&species=${VALUE}" FILE_NAME="${FILE_PATH_AA}/${REPERTOIRE}_aa_${KEY}_${CHAIN}.fasta" TMP_FILE="${FILE_NAME}.tmp" #echo $URL @@ -140,7 +140,7 @@ do echo "|---- Ig" for CHAIN in IGH IGK IGL do - URL="http://www.imgt.org/IMGT_GENE-DB/GENElect?query=8.1+${CHAIN}V&species=${VALUE}&IMGTlabel=L-PART1+L-PART2" + URL="https://www.imgt.org/genedb/GENElect?query=8.1+${CHAIN}V&species=${VALUE}&IMGTlabel=L-PART1+L-PART2" FILE_NAME="${FILE_PATH}/${REPERTOIRE}_${KEY}_${CHAIN}L.fasta" TMP_FILE="${FILE_NAME}.tmp" #echo $URL @@ -154,7 +154,7 @@ do echo "|---- TCR" for CHAIN in TRA TRB TRG TRD do - URL="http://www.imgt.org/IMGT_GENE-DB/GENElect?query=8.1+${CHAIN}V&species=${VALUE}&IMGTlabel=L-PART1+L-PART2" + URL="https://www.imgt.org/genedb/GENElect?query=8.1+${CHAIN}V&species=${VALUE}&IMGTlabel=L-PART1+L-PART2" FILE_NAME="${FILE_PATH}/${REPERTOIRE}_${KEY}_${CHAIN}L.fasta" TMP_FILE="${FILE_NAME}.tmp" #echo $URL @@ -179,7 +179,7 @@ do QUERY=7.5 fi - URL="http://www.imgt.org/IMGT_GENE-DB/GENElect?query=${QUERY}+${CHAIN}&species=${VALUE}" + URL="https://www.imgt.org/genedb/GENElect?query=${QUERY}+${CHAIN}&species=${VALUE}" FILE_NAME="${FILE_PATH}/${REPERTOIRE}_${KEY}_${CHAIN}.fasta" TMP_FILE="${FILE_NAME}.tmp" #echo $URL @@ -193,7 +193,7 @@ do echo "|---- TCR" for CHAIN in TRAC TRBC TRGC TRDC do - URL="http://www.imgt.org/IMGT_GENE-DB/GENElect?query=14.1+${CHAIN}&species=${VALUE}" + URL="https://www.imgt.org/genedb/GENElect?query=14.1+${CHAIN}&species=${VALUE}" FILE_NAME="${FILE_PATH}/${REPERTOIRE}_${KEY}_${CHAIN}.fasta" TMP_FILE="${FILE_NAME}.tmp" #echo $URL @@ -209,7 +209,7 @@ done # Write download info INFO_FILE=${OUTDIR}/IMGT.yaml -echo -e "source: http://www.imgt.org/IMGT_GENE-DB" > $INFO_FILE +echo -e "source: https://www.imgt.org/genedb" > $INFO_FILE echo -e "date: ${DATE}" >> $INFO_FILE echo -e "species:" >> $INFO_FILE for Q in ${SPECIES_QUERY[@]} From 385fb59608742ea72e3970459c05df1b589172e0 Mon Sep 17 00:00:00 2001 From: Matt De Both Date: Thu, 6 Jul 2023 12:22:55 -0700 Subject: [PATCH 039/111] Bug fix --- bin/fetch_imgt.sh | 1 - 1 file changed, 1 deletion(-) diff --git a/bin/fetch_imgt.sh b/bin/fetch_imgt.sh index 7803a92e..216ccd84 100755 --- a/bin/fetch_imgt.sh +++ b/bin/fetch_imgt.sh @@ -76,7 +76,6 @@ do awk '/
    /{i++}/<\/pre>/{j++}{if(j==2){exit}}{if(i==2 && j==1 && $0!~"^
    "){print}}' $TMP_FILE > $FILE_NAME
 
         # Checking once that file exists and is not empty (checks IMGT server is online)
-        read file
         if [ -s "$FILE_NAME" ]
         then
             echo "IMGT Fasta file exists and is not empty"

From ecf8166400612882382c15d4378db8b8d0e78667 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Tue, 18 Jul 2023 16:05:18 -0400
Subject: [PATCH 040/111] do not output results rename fastq

---
 conf/modules.config | 5 +++++
 1 file changed, 5 insertions(+)

diff --git a/conf/modules.config b/conf/modules.config
index e544f357..6ba28931 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -99,6 +99,11 @@ process {
         ext.args = '--quiet'
     }
 
+    withName: 'RENAME_FASTQ'
+        publishDir = [
+            enabled: false
+        ]
+
     withName: 'MERGE_UMI' {
         publishDir = [
             [

From 128cf0bea74b77e67b00ffb9aa47d9a5a2880738 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Tue, 18 Jul 2023 16:43:31 -0400
Subject: [PATCH 041/111] add rename tsv and fasta

---
 conf/modules.config                         | 11 +++++++++--
 modules/local/rename_file.nf                | 21 +++++++++++++++++++++
 subworkflows/local/assembled_input_check.nf |  9 +++++++--
 3 files changed, 37 insertions(+), 4 deletions(-)
 create mode 100644 modules/local/rename_file.nf

diff --git a/conf/modules.config b/conf/modules.config
index 6ba28931..b30a9af1 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -99,12 +99,19 @@ process {
         ext.args = '--quiet'
     }
 
-    withName: 'RENAME_FASTQ'
+    withName: RENAME_FASTQ {
         publishDir = [
             enabled: false
         ]
+    }
+
+    withName: 'RENAME_FILE_*' {
+        publishDir = [
+            enabled: false
+        ]
+    }
 
-    withName: 'MERGE_UMI' {
+    withName: MERGE_UMI {
         publishDir = [
             [
                 enabled: false
diff --git a/modules/local/rename_file.nf b/modules/local/rename_file.nf
new file mode 100644
index 00000000..6f99ef89
--- /dev/null
+++ b/modules/local/rename_file.nf
@@ -0,0 +1,21 @@
+// Import generic module functions
+process RENAME_FILE {
+    tag "$meta.id"
+    label 'process_low'
+
+    conda "conda-forge::python=3.8.0 conda-forge::biopython=1.74"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/mulled-v2-adc9bb9edc31eb38b3c24786a83b7dfa530e2bea:47d6d7765d7537847ced7dac873190d164146022-0' :
+        'biocontainers/mulled-v2-adc9bb9edc31eb38b3c24786a83b7dfa530e2bea:47d6d7765d7537847ced7dac873190d164146022-0' }"
+
+    input:
+    tuple val(meta), path(file)
+
+    output:
+    tuple val(meta), path("${meta.id}_${file.name}")  , emit: file
+
+    script:
+    """
+    mv ${file} ${meta.id}_${file.name}
+    """
+}
diff --git a/subworkflows/local/assembled_input_check.nf b/subworkflows/local/assembled_input_check.nf
index 3b519c6f..3fa4fc97 100644
--- a/subworkflows/local/assembled_input_check.nf
+++ b/subworkflows/local/assembled_input_check.nf
@@ -4,6 +4,8 @@
 
 include { VALIDATE_INPUT } from '../../modules/local/enchantr/validate_input'
 include { SAMPLESHEET_CHECK as SAMPLESHEET_CHECK_ASSEMBLED } from '../../modules/local/samplesheet_check'
+include { RENAME_FILE as RENAME_FILE_FASTA } from '../../modules/local/rename_file'
+include { RENAME_FILE as RENAME_FILE_TSV } from '../../modules/local/rename_file'
 
 workflow ASSEMBLED_INPUT_CHECK {
     take:
@@ -25,9 +27,12 @@ workflow ASSEMBLED_INPUT_CHECK {
             }
             .set{ ch_metadata }
 
+    ch_unique_fasta = RENAME_FILE_FASTA( ch_metadata.fasta )
+    ch_unique_tsv = RENAME_FILE_TSV( ch_metadata.tsv )
+
     emit:
-    ch_fasta = ch_metadata.fasta
-    ch_tsv = ch_metadata.tsv
+    ch_fasta = ch_unique_fasta
+    ch_tsv = ch_unique_tsv
     validated_input = ch_validated_input
     versions = VALIDATE_INPUT.out.versions
 }

From cc59e984f19b68d2ba45f9b4b93d49f5fabbc0de Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Wed, 19 Jul 2023 09:44:55 -0400
Subject: [PATCH 042/111] collapse duplicates error retry

---
 conf/modules.config | 1 +
 1 file changed, 1 insertion(+)

diff --git a/conf/modules.config b/conf/modules.config
index 47eed705..029b68af 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -396,6 +396,7 @@ process {
             mode: params.publish_dir_mode,
             saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
         ]
+        errorStrategy = 'retry'
     }
 
     // ------------------------------

From b024aa3b544934d3194c08a274c82320ebcb8d0a Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Wed, 19 Jul 2023 09:50:25 -0400
Subject: [PATCH 043/111] added clonal repertoires to report

---
 modules/local/airrflow_report/airrflow_report.nf | 3 +++
 1 file changed, 3 insertions(+)

diff --git a/modules/local/airrflow_report/airrflow_report.nf b/modules/local/airrflow_report/airrflow_report.nf
index 10996b6e..9621d685 100644
--- a/modules/local/airrflow_report/airrflow_report.nf
+++ b/modules/local/airrflow_report/airrflow_report.nf
@@ -27,6 +27,9 @@ process AIRRFLOW_REPORT {
     """
     execute_report.R --report_file ${repertoire_report}
 
+    mkdir repertoire_comparison/repertoires
+    cp *clone-pass.tsv repertoire_comparison/repertoires/
+
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":
         alakazam: \$(Rscript -e "library(alakazam); cat(paste(packageVersion('alakazam'), collapse='.'))")

From d2c41182f17b3d558ba6a63729e3fb43f6d76603 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Wed, 19 Jul 2023 10:12:00 -0400
Subject: [PATCH 044/111] convert required columns to string when needed

---
 bin/check_samplesheet.py | 18 +++++++++++++++---
 1 file changed, 15 insertions(+), 3 deletions(-)

diff --git a/bin/check_samplesheet.py b/bin/check_samplesheet.py
index bc686deb..96f5c1d3 100755
--- a/bin/check_samplesheet.py
+++ b/bin/check_samplesheet.py
@@ -68,16 +68,16 @@ def check_samplesheet(file_in, assembled):
             "age",
         ]
         required_columns_assembled = [
-            "sample_id",
             "filename",
+            "sample_id",
             "subject_id",
             "species",
             "pcr_target_locus",
-            "single_cell",
             "sex",
             "tissue",
             "biomaterial_provider",
             "age",
+            "single_cell",
         ]
         no_whitespaces_raw = [
             "sample_id",
@@ -99,9 +99,17 @@ def check_samplesheet(file_in, assembled):
 
         ## Read header
         header = [x.strip('"') for x in fin.readline().strip().split("\t")]
+
         ## Read tab
         tab = pd.read_csv(file_in, sep="\t", header=0)
 
+        ## Set required columns as strings
+        types_dict = dict()
+        types_dict.update({col: str for col in required_columns_assembled[1:7]})
+        for col, col_type in types_dict.items():
+            tab[col] = tab[col].astype(col_type)
+
+
         # Check that all required columns for assembled and raw samplesheets are there, and do not contain whitespaces
         if assembled:
             for col in required_columns_assembled:
@@ -118,8 +126,12 @@ def check_samplesheet(file_in, assembled):
                             col, no_whitespaces_assembled
                         )
                     )
-
         else:
+            if any(tab["single_cell"].tolist()):
+                print_error(
+                        "Some single cell column values are TRUE. The raw mode only accepts bulk samples. If processing single cell samples, please set the `--mode assembled` flag, and provide an AIRR rearrangement as input."
+                        )
+
             for col in required_columns_raw:
                 if col not in header:
                     print("ERROR: Please check samplesheet header: {} ".format(",".join(header)))

From b2c3e7a5ede33f0b6b8efcd837e31738ecbd4589 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Wed, 19 Jul 2023 10:20:23 -0400
Subject: [PATCH 045/111] update changelog

---
 CHANGELOG.md | 5 +++++
 1 file changed, 5 insertions(+)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 13adb86f..b2dbbb81 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -10,12 +10,17 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0.
 - [#268](https://github.com/nf-core/airrflow/pull/268) Added parameters for FindThreshold in `modules.config`.
 - [#268](https://github.com/nf-core/airrflow/pull/268) Validate samplesheet also for `assembled` samplesheet.
 - [#259](https://github.com/nf-core/airrflow/pull/259) Update to `EnchantR v0.1.3`.
+- [#266](https://github.com/nf-core/airrflow/pull/266) Added clonal reports tables to final report folder.
+- [#266](https://github.com/nf-core/airrflow/pull/266) Added processes to include sampleID to filename in assembled workflow to keep it unique.
+
+
 
 ### `Fixed`
 
 - [#268](https://github.com/nf-core/airrflow/pull/268) Allows for uppercase and lowercase locus in samplesheet `pcr_target_locus`.
 - [#259](https://github.com/nf-core/airrflow/pull/259) Samplesheet only allows data from one species.
 - [#259](https://github.com/nf-core/airrflow/pull/259) Introduced fix for a too long command with hundreds of datasets.
+- [#266](https://github.com/nf-core/airrflow/pull/266) Convert samplesheet required columns to strings when needed.
 
 ### `Dependencies`
 

From 0195f4326d41c6bf34db30b18a9fe54a84e76350 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Wed, 19 Jul 2023 10:21:04 -0400
Subject: [PATCH 046/111] update changelog

---
 CHANGELOG.md | 2 --
 1 file changed, 2 deletions(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index b2dbbb81..9f9dd337 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -13,8 +13,6 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0.
 - [#266](https://github.com/nf-core/airrflow/pull/266) Added clonal reports tables to final report folder.
 - [#266](https://github.com/nf-core/airrflow/pull/266) Added processes to include sampleID to filename in assembled workflow to keep it unique.
 
-
-
 ### `Fixed`
 
 - [#268](https://github.com/nf-core/airrflow/pull/268) Allows for uppercase and lowercase locus in samplesheet `pcr_target_locus`.

From 855b9df80c03ac325f9395cf3fb69595cb458e32 Mon Sep 17 00:00:00 2001
From: nf-core-bot 
Date: Wed, 19 Jul 2023 15:30:01 +0000
Subject: [PATCH 047/111] [automated] Fix linting with Prettier

---
 docs/usage.md | 3 ---
 1 file changed, 3 deletions(-)

diff --git a/docs/usage.md b/docs/usage.md
index dd01fdf3..712fbe3f 100644
--- a/docs/usage.md
+++ b/docs/usage.md
@@ -115,7 +115,6 @@ The required input file for processing raw BCR or TCR bulk targeted sequencing d
 - `filename` for single-cell assembled data: path to `airr_rearrangement.tsv` file, for example the one generated when processing the 10x Genomics scBCRseq / scTCRseq with 10x Genomics cellranger `cellranger vdj` or `cellranger multi`. The field accepts any tsv tables following the [AIRR rearrangement Schema specification](https://docs.airr-community.org/en/stable/datarep/rearrangements.html). See [here](https://support.10xgenomics.com/single-cell-vdj/software/pipelines/latest/output/annotation#airr) for more details on the cellranger output.
 - `filename` for bulk assembled data: path to `sequences.fasta` file, containing the assembled and error-corrected reads.
 
-
 The required input file for processing raw BCR or TCR bulk targeted sequencing data is a sample sheet in TSV format (tab separated). The columns `sample_id`, `filename`, `subject_id`, `species`, `tissue`, `single_cell`, `pcr_target_locus`, `sex`, `age` and `biomaterial_provider` are required.
 
 An example samplesheet is:
@@ -457,5 +456,3 @@ In most cases, you will only need to create a custom config as a one-off but if
 See the main [Nextflow documentation](https://www.nextflow.io/docs/latest/config.html) for more information about creating your own configuration files.
 
 If you have any questions or issues please send us a message on [Slack](https://nf-co.re/join/slack) on the [`#configs` channel](https://nfcore.slack.com/channels/configs).
-
-

From 79ba55ea0fb6d26f7b5e30fd83c6048d3094c843 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Wed, 19 Jul 2023 16:40:25 -0400
Subject: [PATCH 048/111] fix black formatting

---
 bin/check_samplesheet.py | 5 ++---
 1 file changed, 2 insertions(+), 3 deletions(-)

diff --git a/bin/check_samplesheet.py b/bin/check_samplesheet.py
index 96f5c1d3..355caec3 100755
--- a/bin/check_samplesheet.py
+++ b/bin/check_samplesheet.py
@@ -109,7 +109,6 @@ def check_samplesheet(file_in, assembled):
         for col, col_type in types_dict.items():
             tab[col] = tab[col].astype(col_type)
 
-
         # Check that all required columns for assembled and raw samplesheets are there, and do not contain whitespaces
         if assembled:
             for col in required_columns_assembled:
@@ -129,8 +128,8 @@ def check_samplesheet(file_in, assembled):
         else:
             if any(tab["single_cell"].tolist()):
                 print_error(
-                        "Some single cell column values are TRUE. The raw mode only accepts bulk samples. If processing single cell samples, please set the `--mode assembled` flag, and provide an AIRR rearrangement as input."
-                        )
+                    "Some single cell column values are TRUE. The raw mode only accepts bulk samples. If processing single cell samples, please set the `--mode assembled` flag, and provide an AIRR rearrangement as input."
+                )
 
             for col in required_columns_raw:
                 if col not in header:

From 623d60ec2211cec458a95b316a2c001a4080773f Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Sun, 23 Jul 2023 17:47:02 -0400
Subject: [PATCH 049/111] allow passing custom fields buildconsensus

---
 conf/modules.config                           |  5 ++++-
 modules/local/presto/presto_buildconsensus.nf | 11 +++++++----
 2 files changed, 11 insertions(+), 5 deletions(-)

diff --git a/conf/modules.config b/conf/modules.config
index 029b68af..54c24a04 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -178,12 +178,15 @@ process {
         ]
     }
 
-    withName: PRESTO_BUILDCONSENSUS {
+    withName: PRESTO_BUILDCONSENSUS_UMI {
         publishDir = [
             path: { "${params.outdir}/presto/06-build-consensus/${meta.id}" },
             mode: params.publish_dir_mode,
             saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
         ]
+        ext.args = ''
+        ext.args2 = ''
+        ext.args3 = 'ID BARCODE SEQCOUNT PRIMER PRCOUNT PRCONS PRFREQ CONSCOUNT'
     }
 
     withName: PRESTO_POSTCONSENSUS_PAIRSEQ {
diff --git a/modules/local/presto/presto_buildconsensus.nf b/modules/local/presto/presto_buildconsensus.nf
index d5e92621..6f5d9b20 100644
--- a/modules/local/presto/presto_buildconsensus.nf
+++ b/modules/local/presto/presto_buildconsensus.nf
@@ -20,11 +20,14 @@ process PRESTO_BUILDCONSENSUS {
     path "versions.yml" , emit: versions
 
     script:
-    def barcode_field = params.cluster_sets ? "CLUSTER" : "BARCODE"
+    def barcode_field = params.cluster_sets ? 'CLUSTER' : 'BARCODE'
+    def args = task.ext.args ?: ''
+    def args2 = task.ext.args2 ?: ''
+    def args3 = task.ext.args3 ?: ''
     """
-    BuildConsensus.py -s $R1 --bf ${barcode_field} --nproc ${task.cpus} --pf PRIMER --prcons $params.primer_consensus --maxerror $params.buildconsensus_maxerror --maxgap $params.buildconsensus_maxgap --outname ${meta.id}_R1 --log ${meta.id}_R1.log > ${meta.id}_command_log.txt
-    BuildConsensus.py -s $R2 --bf ${barcode_field} --nproc ${task.cpus} --pf PRIMER --prcons $params.primer_consensus --maxerror $params.buildconsensus_maxerror --maxgap $params.buildconsensus_maxgap --outname ${meta.id}_R2 --log ${meta.id}_R2.log >> ${meta.id}_command_log.txt
-    ParseLog.py -l ${meta.id}_R1.log ${meta.id}_R2.log -f ID BARCODE SEQCOUNT PRIMER PRCOUNT PRCONS PRFREQ CONSCOUNT
+    BuildConsensus.py -s $R1 --bf ${barcode_field} --nproc ${task.cpus} --pf PRIMER --prcons ${params.primer_consensus} --maxerror ${params.buildconsensus_maxerror} --maxgap ${params.buildconsensus_maxgap} ${args} --outname ${meta.id}_R1 --log ${meta.id}_R1.log > ${meta.id}_command_log.txt
+    BuildConsensus.py -s $R2 --bf ${barcode_field} --nproc ${task.cpus} --pf PRIMER --prcons ${params.primer_consensus} --maxerror ${params.buildconsensus_maxerror} --maxgap ${params.buildconsensus_maxgap} ${args2} --outname ${meta.id}_R2 --log ${meta.id}_R2.log >> ${meta.id}_command_log.txt
+    ParseLog.py -l ${meta.id}_R1.log ${meta.id}_R2.log -f ${args3}
 
     cat <<-END_VERSIONS > versions.yml
     "${task.process}":

From e2deaa1fbbe9dc32c208151a5489dc250c4b67dd Mon Sep 17 00:00:00 2001
From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com>
Date: Wed, 26 Jul 2023 12:59:37 +0200
Subject: [PATCH 050/111] updated config for threshold report with subsample

---
 conf/modules.config | 6 ++++++
 1 file changed, 6 insertions(+)

diff --git a/conf/modules.config b/conf/modules.config
index 029b68af..0c5a3724 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -434,6 +434,12 @@ process {
             mode: params.publish_dir_mode,
             saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
         ]
+        ext.args = ['findthreshold_method':'gmm',
+            'findthreshold_model':'gamma-norm',
+            'findthreshold_edge':0.9,
+            'findthreshold_cutoff':'user',
+            'findthreshold_spc':0.995,
+            'subsample':10000]
     }
 
     withName: DEFINE_CLONES_COMPUTE {

From e9b59c64eb3d96964c076cabaf0c095157697972 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Wed, 26 Jul 2023 22:05:17 -0400
Subject: [PATCH 051/111] add default params to report threshold

---
 conf/modules.config | 6 ++++++
 1 file changed, 6 insertions(+)

diff --git a/conf/modules.config b/conf/modules.config
index 54c24a04..72a4e4ae 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -437,6 +437,12 @@ process {
             mode: params.publish_dir_mode,
             saveAs: { filename -> filename.equals('versions.yml') ? null : filename }
         ]
+        ext.args = ['findthreshold_method':'gmm',
+            'findthreshold_model':'gamma-norm',
+            'findthreshold_edge':0.9,
+            'findthreshold_cutoff':'user',
+            'findthreshold_spc':0.995,
+            'subsample':8000]
     }
 
     withName: DEFINE_CLONES_COMPUTE {

From 5b53226512b0c48a37feb0de02d5df3b77c4dfe7 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Wed, 26 Jul 2023 23:03:42 -0400
Subject: [PATCH 052/111] fix igphyml param docs

---
 nextflow_schema.json | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/nextflow_schema.json b/nextflow_schema.json
index e6a3365e..b05ac808 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -350,7 +350,7 @@
                 },
                 "igphyml": {
                     "type": "string",
-                    "default": "/usr/local/share/igphyml/src/igphyml",
+                    "default": "/usr/local/bin/igphyml",
                     "description": "Path to IgPhyml executable.",
                     "fa_icon": "fas fa-file"
                 },

From 9a05343e8ec52f02e58f1cb860b61f7899dbf579 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Thu, 27 Jul 2023 21:21:39 -0400
Subject: [PATCH 053/111] partial fix for docker container

---
 conf/modules.config | 1 +
 1 file changed, 1 insertion(+)

diff --git a/conf/modules.config b/conf/modules.config
index 72a4e4ae..0fa05b80 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -479,6 +479,7 @@ process {
                     'minseq':5,
                     'traits':'c_call',
                     'tips':'c_call']
+        ext.singularity_pull_docker_container = true
     }
 
     // -------------------------------

From 6f44bbd6f0566300d83688b53d3dc108d66741fa Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Thu, 27 Jul 2023 21:28:36 -0400
Subject: [PATCH 054/111] update changelog

---
 CHANGELOG.md | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 9f9dd337..5cee8f39 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -12,13 +12,14 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0.
 - [#259](https://github.com/nf-core/airrflow/pull/259) Update to `EnchantR v0.1.3`.
 - [#266](https://github.com/nf-core/airrflow/pull/266) Added clonal reports tables to final report folder.
 - [#266](https://github.com/nf-core/airrflow/pull/266) Added processes to include sampleID to filename in assembled workflow to keep it unique.
-
+- [#276](https://github.com/nf-core/airrflow/pull/276) Parametrize FindThreshold Report and Presto Buildconsensus UMI.
 ### `Fixed`
 
 - [#268](https://github.com/nf-core/airrflow/pull/268) Allows for uppercase and lowercase locus in samplesheet `pcr_target_locus`.
 - [#259](https://github.com/nf-core/airrflow/pull/259) Samplesheet only allows data from one species.
 - [#259](https://github.com/nf-core/airrflow/pull/259) Introduced fix for a too long command with hundreds of datasets.
 - [#266](https://github.com/nf-core/airrflow/pull/266) Convert samplesheet required columns to strings when needed.
+- [#276](https://github.com/nf-core/airrflow/pull/266) Temporary fix for Dowser with singularity
 
 ### `Dependencies`
 

From 85d533aaabba61a97ea42d9ff68ee88b4aa98f18 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Fri, 28 Jul 2023 13:39:27 -0400
Subject: [PATCH 055/111] update nextflow config

---
 CHANGELOG.md    | 1 +
 nextflow.config | 6 ++++--
 2 files changed, 5 insertions(+), 2 deletions(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 5cee8f39..785ff83a 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -13,6 +13,7 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0.
 - [#266](https://github.com/nf-core/airrflow/pull/266) Added clonal reports tables to final report folder.
 - [#266](https://github.com/nf-core/airrflow/pull/266) Added processes to include sampleID to filename in assembled workflow to keep it unique.
 - [#276](https://github.com/nf-core/airrflow/pull/276) Parametrize FindThreshold Report and Presto Buildconsensus UMI.
+
 ### `Fixed`
 
 - [#268](https://github.com/nf-core/airrflow/pull/268) Allows for uppercase and lowercase locus in samplesheet `pcr_target_locus`.
diff --git a/nextflow.config b/nextflow.config
index 77d8ef57..21647655 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -157,8 +157,10 @@ try {
 // } catch (Exception e) {
 //   System.err.println("WARNING: Could not load nf-core/config/airrflow profiles: ${params.custom_config_base}/pipeline/airrflow.config")
 // }
-docker.registry = 'quay.io'
-podman.registry = 'quay.io'
+apptainer.registry   = 'quay.io'
+docker.registry      = 'quay.io'
+podman.registry      = 'quay.io'
+singularity.registry = 'quay.io'
 
 profiles {
     debug {

From 9828750854bbec7c60a042843577d1ed668707ff Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Fri, 28 Jul 2023 13:43:56 -0400
Subject: [PATCH 056/111] try fix docker singularity issue

---
 conf/modules.config | 1 -
 1 file changed, 1 deletion(-)

diff --git a/conf/modules.config b/conf/modules.config
index 0fa05b80..72a4e4ae 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -479,7 +479,6 @@ process {
                     'minseq':5,
                     'traits':'c_call',
                     'tips':'c_call']
-        ext.singularity_pull_docker_container = true
     }
 
     // -------------------------------

From f738e5b9adef750e4ea3a224f987d1b9c75a9b56 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet Garriga 
Date: Sat, 29 Jul 2023 11:14:12 -0400
Subject: [PATCH 057/111] add skip report threshold

---
 nextflow.config                       |  1 +
 nextflow_schema.json                  |  5 +++++
 subworkflows/local/clonal_analysis.nf | 15 ++++++++-------
 3 files changed, 14 insertions(+), 7 deletions(-)

diff --git a/nextflow.config b/nextflow.config
index 21647655..2b226b99 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -79,6 +79,7 @@ params {
     singlecell = 'single_cell'
     clonal_threshold = 'auto'
     skip_all_clones_report = false
+    skip_report_threshold = false
 
     // tree lineage options
     igphyml="/usr/local/bin/igphyml"
diff --git a/nextflow_schema.json b/nextflow_schema.json
index b05ac808..541fb42d 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -364,6 +364,11 @@
                     "type": "boolean",
                     "description": "Skip report of EnchantR DefineClones for all samples together.",
                     "fa_icon": "fas fa-angle-double-right"
+                },
+                "skip_report_threshold": {
+                    "type": "boolean",
+                    "description": "Skip report of EnchantR FindThreshold for all samples together.",
+                    "fa_icon": "fas fa-angle-double-right"
                 }
             },
             "help_text": "By default, the pipeline will define clones for each of the samples, as two sequences having the same V-gene assignment, C-gene assignment, J-gene assignment, and junction length. Additionally, the similarity of the CDR3 sequences will be assessed by Hamming distances. \n\nA distance threshold for determining if two sequences come from the same clone or not is automatically determined by the process find threshold. Alternatively, a hamming distance threshold can be  manually set by setting the `--clonal_threshold` parameter.",
diff --git a/subworkflows/local/clonal_analysis.nf b/subworkflows/local/clonal_analysis.nf
index ff4afacf..2907fa2a 100644
--- a/subworkflows/local/clonal_analysis.nf
+++ b/subworkflows/local/clonal_analysis.nf
@@ -51,13 +51,14 @@ workflow CLONAL_ANALYSIS {
                         .dump(tag: 'ch_find_threshold_samplesheet')
                         .collectFile(name: 'find_threshold_samplesheet.txt', newLine: true)
 
-        REPORT_THRESHOLD (
-            ch_find_threshold,
-            ch_logo,
-            ch_find_threshold_samplesheet
-        )
-        ch_versions = ch_versions.mix(REPORT_THRESHOLD.out.versions)
-
+        if !(params.skip_report_threshold){
+            REPORT_THRESHOLD (
+                ch_find_threshold,
+                ch_logo,
+                ch_find_threshold_samplesheet
+            )
+            ch_versions = ch_versions.mix(REPORT_THRESHOLD.out.versions)
+        }
     }
 
     // prepare ch for define clones

From a05bcfff08eb22f4ee28ce038fa26788753d7b97 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet Garriga 
Date: Sat, 29 Jul 2023 11:20:57 -0400
Subject: [PATCH 058/111] fix param skip threshold

---
 subworkflows/local/clonal_analysis.nf | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/subworkflows/local/clonal_analysis.nf b/subworkflows/local/clonal_analysis.nf
index 2907fa2a..b4c413f6 100644
--- a/subworkflows/local/clonal_analysis.nf
+++ b/subworkflows/local/clonal_analysis.nf
@@ -51,7 +51,7 @@ workflow CLONAL_ANALYSIS {
                         .dump(tag: 'ch_find_threshold_samplesheet')
                         .collectFile(name: 'find_threshold_samplesheet.txt', newLine: true)
 
-        if !(params.skip_report_threshold){
+        if (!params.skip_report_threshold){
             REPORT_THRESHOLD (
                 ch_find_threshold,
                 ch_logo,

From 9a00f038d213d3a03c7a178fc51fd2904dfdb622 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Sat, 29 Jul 2023 12:55:34 -0400
Subject: [PATCH 059/111] add immcantation container for dowser

---
 modules/local/enchantr/dowser_lineages.nf | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/modules/local/enchantr/dowser_lineages.nf b/modules/local/enchantr/dowser_lineages.nf
index 2e398f58..1e0ca243 100644
--- a/modules/local/enchantr/dowser_lineages.nf
+++ b/modules/local/enchantr/dowser_lineages.nf
@@ -24,7 +24,7 @@ process DOWSER_LINEAGES {
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/immcantation/suite:devel' }"
 
     input:
     tuple val(meta), path(tabs)

From feedb3f52bad2f51c00ef2ec579eda517c7dbcba Mon Sep 17 00:00:00 2001
From: ssnn-airr <20683719+ssnn-airr@users.noreply.github.com>
Date: Tue, 1 Aug 2023 09:05:29 +0200
Subject: [PATCH 060/111] updated path for enchantr 0.1.4

---
 docs/output.md                           | 6 +++---
 modules/local/enchantr/find_threshold.nf | 4 ++--
 2 files changed, 5 insertions(+), 5 deletions(-)

diff --git a/docs/output.md b/docs/output.md
index e2477c8d..e6632c57 100644
--- a/docs/output.md
+++ b/docs/output.md
@@ -388,10 +388,10 @@ This folder is genereated when `detect_contamination` is set to `true`.
 
 - `clonal_analysis/find_threshold/`
   - `*log`: Log of the process that will be parsed to generate a report.
-  - `all_reps_threshold-mean.tsv`: Mean of all hamming distance thresholds of the
-    Junction regions as determined by Shazam.
-  - `all_reps_threshold-summary.tsv`: Thresholds for each group of `--cloneby` samples.
   - `all_reps_dist_report`: Report
+    - `tables/all_reps_threshold-mean.tsv`: Mean of all hamming distance thresholds of the
+    Junction regions as determined by Shazam.
+    - `tables/all_reps_threshold-summary.tsv`: Thresholds for each group of `--cloneby` samples.
 
 
 
diff --git a/modules/local/enchantr/find_threshold.nf b/modules/local/enchantr/find_threshold.nf
index 32ff652e..a87759b1 100644
--- a/modules/local/enchantr/find_threshold.nf
+++ b/modules/local/enchantr/find_threshold.nf
@@ -36,8 +36,8 @@ process FIND_THRESHOLD {
     // tuple val(meta), path("*threshold-pass.tsv"), emit: tab // sequence tsv in AIRR format
     path("*_command_log.txt"), emit: logs //process logs
     path "*_report"
-    path "*_threshold-summary.tsv", emit: threshold_summary
-    path "*_threshold-mean.tsv", emit: mean_threshold
+    path "all_reps_dist_report/tables/*_threshold-summary.tsv", emit: threshold_summary
+    path "all_reps_dist_report/tables/*_threshold-mean.tsv", emit: mean_threshold
     path "versions.yml", emit: versions
 
     script:

From 33da6e5bbe6e9b3dd3d32e5cb5fd20c2b1546287 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet Garriga 
Date: Mon, 18 Sep 2023 18:00:35 -0400
Subject: [PATCH 061/111] test immcantation suite prerelease

---
 modules/local/airrflow_report/airrflow_report.nf | 4 ++--
 modules/local/enchantr/collapse_duplicates.nf    | 4 ++--
 modules/local/enchantr/define_clones.nf          | 4 ++--
 modules/local/enchantr/detect_contamination.nf   | 4 ++--
 modules/local/enchantr/dowser_lineages.nf        | 2 +-
 modules/local/enchantr/find_threshold.nf         | 4 ++--
 modules/local/enchantr/remove_chimeric.nf        | 4 ++--
 modules/local/enchantr/report_file_size.nf       | 4 ++--
 modules/local/enchantr/single_cell_qc.nf         | 4 ++--
 modules/local/enchantr/validate_input.nf         | 4 ++--
 modules/local/reveal/add_meta_to_tab.nf          | 4 ++--
 modules/local/reveal/filter_junction_mod3.nf     | 4 ++--
 modules/local/reveal/filter_quality.nf           | 4 ++--
 13 files changed, 25 insertions(+), 25 deletions(-)

diff --git a/modules/local/airrflow_report/airrflow_report.nf b/modules/local/airrflow_report/airrflow_report.nf
index 9621d685..856b33ab 100644
--- a/modules/local/airrflow_report/airrflow_report.nf
+++ b/modules/local/airrflow_report/airrflow_report.nf
@@ -4,8 +4,8 @@ process AIRRFLOW_REPORT {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     tuple val(meta), path(tab) // sequence tsv table in AIRR format
diff --git a/modules/local/enchantr/collapse_duplicates.nf b/modules/local/enchantr/collapse_duplicates.nf
index 2257913f..7308c092 100644
--- a/modules/local/enchantr/collapse_duplicates.nf
+++ b/modules/local/enchantr/collapse_duplicates.nf
@@ -6,8 +6,8 @@ process COLLAPSE_DUPLICATES {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     tuple val(meta), path(tabs) // tuple [val(meta), sequence tsv in AIRR format ]
diff --git a/modules/local/enchantr/define_clones.nf b/modules/local/enchantr/define_clones.nf
index 7321603a..839b2463 100644
--- a/modules/local/enchantr/define_clones.nf
+++ b/modules/local/enchantr/define_clones.nf
@@ -23,8 +23,8 @@ process DEFINE_CLONES {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     tuple val(meta), path(tabs) // meta, sequence tsv in AIRR format
diff --git a/modules/local/enchantr/detect_contamination.nf b/modules/local/enchantr/detect_contamination.nf
index 003c2126..161865dd 100644
--- a/modules/local/enchantr/detect_contamination.nf
+++ b/modules/local/enchantr/detect_contamination.nf
@@ -7,8 +7,8 @@ process DETECT_CONTAMINATION {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     path(tabs)
diff --git a/modules/local/enchantr/dowser_lineages.nf b/modules/local/enchantr/dowser_lineages.nf
index 1e0ca243..7db286d0 100644
--- a/modules/local/enchantr/dowser_lineages.nf
+++ b/modules/local/enchantr/dowser_lineages.nf
@@ -23,7 +23,7 @@ process DOWSER_LINEAGES {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
+        'docker.io/ssnn/suite:prerelease':
         'docker.io/immcantation/suite:devel' }"
 
     input:
diff --git a/modules/local/enchantr/find_threshold.nf b/modules/local/enchantr/find_threshold.nf
index a87759b1..67f792d2 100644
--- a/modules/local/enchantr/find_threshold.nf
+++ b/modules/local/enchantr/find_threshold.nf
@@ -23,8 +23,8 @@ process FIND_THRESHOLD {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
 
     input:
diff --git a/modules/local/enchantr/remove_chimeric.nf b/modules/local/enchantr/remove_chimeric.nf
index 41467ecb..5095a43f 100644
--- a/modules/local/enchantr/remove_chimeric.nf
+++ b/modules/local/enchantr/remove_chimeric.nf
@@ -7,8 +7,8 @@ process REMOVE_CHIMERIC {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
 
     input:
diff --git a/modules/local/enchantr/report_file_size.nf b/modules/local/enchantr/report_file_size.nf
index c9a2052c..6ff1558c 100644
--- a/modules/local/enchantr/report_file_size.nf
+++ b/modules/local/enchantr/report_file_size.nf
@@ -8,8 +8,8 @@ process REPORT_FILE_SIZE {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     path logs
diff --git a/modules/local/enchantr/single_cell_qc.nf b/modules/local/enchantr/single_cell_qc.nf
index 3275c523..e8cf8830 100644
--- a/modules/local/enchantr/single_cell_qc.nf
+++ b/modules/local/enchantr/single_cell_qc.nf
@@ -22,8 +22,8 @@ process SINGLE_CELL_QC {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     path(tabs)
diff --git a/modules/local/enchantr/validate_input.nf b/modules/local/enchantr/validate_input.nf
index fd6bd345..e503ddf7 100644
--- a/modules/local/enchantr/validate_input.nf
+++ b/modules/local/enchantr/validate_input.nf
@@ -8,8 +8,8 @@ process VALIDATE_INPUT {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     file samplesheet
diff --git a/modules/local/reveal/add_meta_to_tab.nf b/modules/local/reveal/add_meta_to_tab.nf
index f24433e2..71a2de00 100644
--- a/modules/local/reveal/add_meta_to_tab.nf
+++ b/modules/local/reveal/add_meta_to_tab.nf
@@ -5,8 +5,8 @@ process ADD_META_TO_TAB {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     cache 'deep' // Without 'deep' this process would run when using -resume
 
diff --git a/modules/local/reveal/filter_junction_mod3.nf b/modules/local/reveal/filter_junction_mod3.nf
index 841fbba9..246d3b25 100644
--- a/modules/local/reveal/filter_junction_mod3.nf
+++ b/modules/local/reveal/filter_junction_mod3.nf
@@ -5,8 +5,8 @@ process FILTER_JUNCTION_MOD3 {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     tuple val(meta), path(tab) // sequence tsv in AIRR format
diff --git a/modules/local/reveal/filter_quality.nf b/modules/local/reveal/filter_quality.nf
index a649caef..4287c562 100644
--- a/modules/local/reveal/filter_quality.nf
+++ b/modules/local/reveal/filter_quality.nf
@@ -5,8 +5,8 @@ process FILTER_QUALITY {
 
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'https://depot.galaxyproject.org/singularity/r-enchantr:0.1.3--r42hdfd78af_0':
-        'biocontainers/r-enchantr:0.1.3--r42hdfd78af_0' }"
+        'docker.io/ssnn/suite:prerelease':
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     tuple val(meta), path(tab) // sequence tsv in AIRR format

From 216706e3034e4739b0b8a330a6e736d421734107 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet Garriga 
Date: Mon, 18 Sep 2023 18:37:48 -0400
Subject: [PATCH 062/111] update path igphyml

---
 nextflow.config      | 2 +-
 nextflow_schema.json | 2 +-
 2 files changed, 2 insertions(+), 2 deletions(-)

diff --git a/nextflow.config b/nextflow.config
index 2b226b99..b929a34d 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -82,7 +82,7 @@ params {
     skip_report_threshold = false
 
     // tree lineage options
-    igphyml="/usr/local/bin/igphyml"
+    igphyml="/usr/local/share/igphyml/src/igphyml"
     skip_lineage = false
 
     // -----------------------
diff --git a/nextflow_schema.json b/nextflow_schema.json
index 541fb42d..511deb29 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -350,7 +350,7 @@
                 },
                 "igphyml": {
                     "type": "string",
-                    "default": "/usr/local/bin/igphyml",
+                    "default": "/usr/local/share/igphyml/src/igphyml",
                     "description": "Path to IgPhyml executable.",
                     "fa_icon": "fas fa-file"
                 },

From 0b44403f5820a5d9b009e13822468f7a262d75b0 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Tue, 19 Sep 2023 10:25:08 -0400
Subject: [PATCH 063/111] change dowser lineages container

---
 conf/test_full.config                     | 9 +++++++++
 modules/local/enchantr/dowser_lineages.nf | 2 +-
 2 files changed, 10 insertions(+), 1 deletion(-)

diff --git a/conf/test_full.config b/conf/test_full.config
index 52781925..0b028c4c 100644
--- a/conf/test_full.config
+++ b/conf/test_full.config
@@ -28,3 +28,12 @@ params {
     umi_start = 0
     umi_position = 'R1'
 }
+
+process {
+  withName:DOWSER_LINEAGES{
+            ext.args = ['build':'igphyml',
+                        'minseq':5,
+                        'traits':'c_primer',
+                        'tips':'c_primer']
+  }
+}
diff --git a/modules/local/enchantr/dowser_lineages.nf b/modules/local/enchantr/dowser_lineages.nf
index 7db286d0..7f173c37 100644
--- a/modules/local/enchantr/dowser_lineages.nf
+++ b/modules/local/enchantr/dowser_lineages.nf
@@ -24,7 +24,7 @@ process DOWSER_LINEAGES {
     conda "bioconda::r-enchantr=0.1.3"
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
         'docker.io/ssnn/suite:prerelease':
-        'docker.io/immcantation/suite:devel' }"
+        'docker.io/ssnn/suite:prerelease' }"
 
     input:
     tuple val(meta), path(tabs)

From 58792cef13f0f6eced74b7f4819968191d6bcee2 Mon Sep 17 00:00:00 2001
From: nf-core-bot 
Date: Mon, 25 Sep 2023 14:10:31 +0000
Subject: [PATCH 064/111] [automated] Fix linting with Prettier

---
 docs/output.md | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/docs/output.md b/docs/output.md
index e6632c57..cf269b42 100644
--- a/docs/output.md
+++ b/docs/output.md
@@ -390,7 +390,7 @@ This folder is genereated when `detect_contamination` is set to `true`.
   - `*log`: Log of the process that will be parsed to generate a report.
   - `all_reps_dist_report`: Report
     - `tables/all_reps_threshold-mean.tsv`: Mean of all hamming distance thresholds of the
-    Junction regions as determined by Shazam.
+      Junction regions as determined by Shazam.
     - `tables/all_reps_threshold-summary.tsv`: Thresholds for each group of `--cloneby` samples.
 
 

From db93f270cfc61d0bf39e4cfb869d709c3a6be88a Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Mon, 25 Sep 2023 10:13:25 -0400
Subject: [PATCH 065/111] fix editorconfig linting

---
 conf/test_full.config | 12 ++++++------
 1 file changed, 6 insertions(+), 6 deletions(-)

diff --git a/conf/test_full.config b/conf/test_full.config
index 0b028c4c..8196a9d3 100644
--- a/conf/test_full.config
+++ b/conf/test_full.config
@@ -30,10 +30,10 @@ params {
 }
 
 process {
-  withName:DOWSER_LINEAGES{
-            ext.args = ['build':'igphyml',
-                        'minseq':5,
-                        'traits':'c_primer',
-                        'tips':'c_primer']
-  }
+    withName:DOWSER_LINEAGES{
+        ext.args = ['build':'igphyml',
+                    'minseq':5,
+                    'traits':'c_primer',
+                    'tips':'c_primer']
+    }
 }

From 710acccf8ff7143c202cdd9b6006429a715a69b4 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Mon, 25 Sep 2023 12:04:34 -0400
Subject: [PATCH 066/111] add input schema

---
 assets/schema_input.json | 57 ++++++++++++++++++++++++++++++++++++++++
 nextflow_schema.json     |  2 +-
 2 files changed, 58 insertions(+), 1 deletion(-)
 create mode 100644 assets/schema_input.json

diff --git a/assets/schema_input.json b/assets/schema_input.json
new file mode 100644
index 00000000..cdddf739
--- /dev/null
+++ b/assets/schema_input.json
@@ -0,0 +1,57 @@
+{
+    "$schema": "http://json-schema.org/draft-07/schema",
+    "$id": "https://raw.githubusercontent.com/nf-core/airrflow/master/assets/schema_input.json",
+    "title": "nf-core/airrflow pipeline - params.input schema",
+    "description": "Schema for the file provided with params.input",
+    "type": "array",
+    "items": {
+        "type": "object",
+        "properties": {
+            "sample_id": {
+                "type": "string",
+                "pattern": "^\\S+$",
+                "errorMessage": "Sample name must be provided and cannot contain spaces"
+            },
+            "subject_id": {
+                "type": "string",
+                "pattern": "^\\S+$",
+                "errorMessage": "Subject name must be provided and cannot contain spaces"
+            },
+            "species": {
+                "type": "string",
+                "enum": ["mouse", "human"],
+                "errorMessage": "Species name must be provided and must be one of: mouse, human"
+            },
+            "pcr_target_locus": {
+                "type": "string",
+                "enum": ["TR", "IG"],
+                "errorMessage": "PCR target locus must be provided and must be one of: TR, IG"
+            },
+            "tissue": {
+                "type": "string",
+                "pattern": "^\\S+$",
+                "errorMessage": "Tissue name must be provided and cannot contain spaces"
+            },
+            "sex": {
+                "type": "string",
+                "pattern": "^\\S+$",
+                "errorMessage": "Sex must be provided, specify NA if unknown."
+            },
+            "age": {
+                "type": "string",
+                "errorMessage": "Age must be provided, specify NA if unknown."
+            },
+            "biomaterial_provider": {
+                "type": "string",
+                "pattern": "^\\S+$",
+                "errorMessage": "Biomaterial provider must be provided and cannot contain spaces"
+            },
+            "single_cell": {
+                "type": "boolean",
+                "pattern": "^\\S+$",
+                "errorMessage": "Single cell must be provided as a TRUE/FALSE value"
+            }
+        },
+        "required": ["sample_id", "subject_id", "species", "pcr_target_locus", "tissue", "sex", "age", "biomaterial_provider" ]
+    }
+}
\ No newline at end of file
diff --git a/nextflow_schema.json b/nextflow_schema.json
index d0261195..e1e77e77 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -17,7 +17,7 @@
                     "format": "file-path",
                     "exists": true,
                     "mimetype": "text/csv",
-                    "pattern": "^\\S+\\.csv$",
+                    "pattern": "^\\S+\\.tsv$",
                     "schema": "assets/schema_input.json",
                     "description": "Path to comma-separated file containing information about the samples in the experiment.",
                     "help_text": "You will need to create a design file with information about the samples in your experiment before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row. See [usage docs](https://nf-co.re/airrflow/usage#samplesheet-input).",

From 78072bd92bb2bb467147db2e58d35ef03ad2ec1c Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Mon, 25 Sep 2023 15:12:34 -0400
Subject: [PATCH 067/111] fix samplesheet validation

---
 assets/schema_input.json | 17 ++++++++---------
 nextflow.config          |  2 ++
 2 files changed, 10 insertions(+), 9 deletions(-)

diff --git a/assets/schema_input.json b/assets/schema_input.json
index cdddf739..eb1c54eb 100644
--- a/assets/schema_input.json
+++ b/assets/schema_input.json
@@ -10,27 +10,27 @@
             "sample_id": {
                 "type": "string",
                 "pattern": "^\\S+$",
-                "errorMessage": "Sample name must be provided and cannot contain spaces"
+                "errorMessage": "Sample name must be provided and cannot contain spaces."
             },
             "subject_id": {
                 "type": "string",
                 "pattern": "^\\S+$",
-                "errorMessage": "Subject name must be provided and cannot contain spaces"
+                "errorMessage": "Subject name must be provided and cannot contain spaces."
             },
             "species": {
                 "type": "string",
                 "enum": ["mouse", "human"],
-                "errorMessage": "Species name must be provided and must be one of: mouse, human"
+                "errorMessage": "Species name must be provided and must be one of: mouse, human."
             },
             "pcr_target_locus": {
                 "type": "string",
-                "enum": ["TR", "IG"],
-                "errorMessage": "PCR target locus must be provided and must be one of: TR, IG"
+                "enum": ["TR", "IG", "ig", "tr", "Ig", "Tr"],
+                "errorMessage": "PCR target locus must be provided and must be one of: TR, IG."
             },
             "tissue": {
                 "type": "string",
                 "pattern": "^\\S+$",
-                "errorMessage": "Tissue name must be provided and cannot contain spaces"
+                "errorMessage": "Tissue name must be provided and cannot contain spaces."
             },
             "sex": {
                 "type": "string",
@@ -43,13 +43,12 @@
             },
             "biomaterial_provider": {
                 "type": "string",
-                "pattern": "^\\S+$",
-                "errorMessage": "Biomaterial provider must be provided and cannot contain spaces"
+                "errorMessage": "Biomaterial provider must be provided."
             },
             "single_cell": {
                 "type": "boolean",
                 "pattern": "^\\S+$",
-                "errorMessage": "Single cell must be provided as a TRUE/FALSE value"
+                "errorMessage": "Single cell must be provided as a TRUE/FALSE value."
             }
         },
         "required": ["sample_id", "subject_id", "species", "pcr_target_locus", "tissue", "sex", "age", "biomaterial_provider" ]
diff --git a/nextflow.config b/nextflow.config
index d67b5933..c4d958c6 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -294,6 +294,8 @@ env {
     PYTHONNOUSERSITE = 1
     R_PROFILE_USER   = "/.Rprofile"
     R_ENVIRON_USER   = "/.Renviron"
+    R_LIBS_SITE = "NULL"
+    R_LIBS_USER = "NULL"
     JULIA_DEPOT_PATH = "/usr/local/share/julia"
 }
 

From 6db55b0a178008e04e8f16077093bf12a739174a Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Mon, 25 Sep 2023 15:14:05 -0400
Subject: [PATCH 068/111] update nextflow ver

---
 .github/workflows/ci_immcantation.yml | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/.github/workflows/ci_immcantation.yml b/.github/workflows/ci_immcantation.yml
index 8669923d..b2b1dff9 100644
--- a/.github/workflows/ci_immcantation.yml
+++ b/.github/workflows/ci_immcantation.yml
@@ -23,7 +23,7 @@ jobs:
     strategy:
       matrix:
         NXF_VER:
-          - "22.10.1"
+          - "23.04.0"
           - "latest-everything"
         profile:
           [

From 56756a269759dab02b1417cd519022e50b0cf57b Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Mon, 25 Sep 2023 15:28:02 -0400
Subject: [PATCH 069/111] fix nextflow badge

---
 README.md | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/README.md b/README.md
index 4150fa26..7fb75a1c 100644
--- a/README.md
+++ b/README.md
@@ -4,7 +4,7 @@
 [![GitHub Actions Linting Status](https://github.com/nf-core/airrflow/workflows/nf-core%20linting/badge.svg)](https://github.com/nf-core/airrflow/actions?query=workflow%3A%22nf-core+linting%22)
 [![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/airrflow/results)
 [![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.2642009-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.2642009)
-[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A522.10.1-23aa62.svg)](https://www.nextflow.io/)
+[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/)
 [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)
 [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/)
 [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/)

From 61b34035b0c85fdd24f266f952f9036d31b818e5 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Mon, 25 Sep 2023 15:41:08 -0400
Subject: [PATCH 070/111] fix lint errors

---
 .nf-core.yml              |  2 ++
 assets/multiqc_config.yml |  2 +-
 assets/schema_input.json  | 13 +++++++++++--
 3 files changed, 14 insertions(+), 3 deletions(-)

diff --git a/.nf-core.yml b/.nf-core.yml
index 2c0141ff..4ae6f7f0 100644
--- a/.nf-core.yml
+++ b/.nf-core.yml
@@ -1,4 +1,6 @@
 lint:
   files_exist:
     - conf/igenomes.config
+  multiqc_config:
+    - report_comment
 repository_type: pipeline
diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml
index 1bd4a16b..889351d6 100644
--- a/assets/multiqc_config.yml
+++ b/assets/multiqc_config.yml
@@ -1,4 +1,4 @@
-report_comment: >
+report_comment:
   This report has been generated by the nf-core/airrflow
   analysis pipeline. For information about how to interpret these results, please see the
   documentation.
diff --git a/assets/schema_input.json b/assets/schema_input.json
index eb1c54eb..327564f0 100644
--- a/assets/schema_input.json
+++ b/assets/schema_input.json
@@ -51,6 +51,15 @@
                 "errorMessage": "Single cell must be provided as a TRUE/FALSE value."
             }
         },
-        "required": ["sample_id", "subject_id", "species", "pcr_target_locus", "tissue", "sex", "age", "biomaterial_provider" ]
+        "required": [
+            "sample_id",
+            "subject_id",
+            "species",
+            "pcr_target_locus",
+            "tissue",
+            "sex",
+            "age",
+            "biomaterial_provider"
+        ]
     }
-}
\ No newline at end of file
+}

From c9321eef03a05b25f8c8dcd35d2ea4a40cd8c331 Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Mon, 25 Sep 2023 16:25:15 -0400
Subject: [PATCH 071/111] update to immcantation/airrflow container

---
 modules/local/airrflow_report/airrflow_report.nf | 8 +++++---
 modules/local/enchantr/collapse_duplicates.nf    | 8 +++++---
 modules/local/enchantr/define_clones.nf          | 8 +++++---
 modules/local/enchantr/detect_contamination.nf   | 8 +++++---
 modules/local/enchantr/dowser_lineages.nf        | 8 +++++---
 modules/local/enchantr/find_threshold.nf         | 8 +++++---
 modules/local/enchantr/remove_chimeric.nf        | 8 +++++---
 modules/local/enchantr/report_file_size.nf       | 8 +++++---
 modules/local/enchantr/single_cell_qc.nf         | 8 +++++---
 modules/local/enchantr/validate_input.nf         | 8 +++++---
 modules/local/reveal/add_meta_to_tab.nf          | 8 +++++---
 modules/local/reveal/filter_junction_mod3.nf     | 8 +++++---
 modules/local/reveal/filter_quality.nf           | 8 +++++---
 13 files changed, 65 insertions(+), 39 deletions(-)

diff --git a/modules/local/airrflow_report/airrflow_report.nf b/modules/local/airrflow_report/airrflow_report.nf
index 856b33ab..0ba78193 100644
--- a/modules/local/airrflow_report/airrflow_report.nf
+++ b/modules/local/airrflow_report/airrflow_report.nf
@@ -2,10 +2,12 @@ process AIRRFLOW_REPORT {
     tag "${meta.id}"
     label 'process_high'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     tuple val(meta), path(tab) // sequence tsv table in AIRR format
diff --git a/modules/local/enchantr/collapse_duplicates.nf b/modules/local/enchantr/collapse_duplicates.nf
index 7308c092..6880de53 100644
--- a/modules/local/enchantr/collapse_duplicates.nf
+++ b/modules/local/enchantr/collapse_duplicates.nf
@@ -4,10 +4,12 @@ process COLLAPSE_DUPLICATES {
     label 'process_long_parallelized'
     label 'immcantation'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     tuple val(meta), path(tabs) // tuple [val(meta), sequence tsv in AIRR format ]
diff --git a/modules/local/enchantr/define_clones.nf b/modules/local/enchantr/define_clones.nf
index 839b2463..8f843516 100644
--- a/modules/local/enchantr/define_clones.nf
+++ b/modules/local/enchantr/define_clones.nf
@@ -21,10 +21,12 @@ process DEFINE_CLONES {
     label 'process_long_parallelized'
     label 'immcantation'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     tuple val(meta), path(tabs) // meta, sequence tsv in AIRR format
diff --git a/modules/local/enchantr/detect_contamination.nf b/modules/local/enchantr/detect_contamination.nf
index 161865dd..6cdc2fa5 100644
--- a/modules/local/enchantr/detect_contamination.nf
+++ b/modules/local/enchantr/detect_contamination.nf
@@ -5,10 +5,12 @@ process DETECT_CONTAMINATION {
     label 'immcantation'
 
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     path(tabs)
diff --git a/modules/local/enchantr/dowser_lineages.nf b/modules/local/enchantr/dowser_lineages.nf
index 7f173c37..51930bb9 100644
--- a/modules/local/enchantr/dowser_lineages.nf
+++ b/modules/local/enchantr/dowser_lineages.nf
@@ -21,10 +21,12 @@ process DOWSER_LINEAGES {
     label 'process_long_parallelized'
     label 'immcantation'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     tuple val(meta), path(tabs)
diff --git a/modules/local/enchantr/find_threshold.nf b/modules/local/enchantr/find_threshold.nf
index 67f792d2..8f3a533b 100644
--- a/modules/local/enchantr/find_threshold.nf
+++ b/modules/local/enchantr/find_threshold.nf
@@ -21,10 +21,12 @@ process FIND_THRESHOLD {
     label 'process_long_parallelized'
     label 'immcantation'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
 
     input:
diff --git a/modules/local/enchantr/remove_chimeric.nf b/modules/local/enchantr/remove_chimeric.nf
index 5095a43f..2489362e 100644
--- a/modules/local/enchantr/remove_chimeric.nf
+++ b/modules/local/enchantr/remove_chimeric.nf
@@ -5,10 +5,12 @@ process REMOVE_CHIMERIC {
     label 'immcantation'
 
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
 
     input:
diff --git a/modules/local/enchantr/report_file_size.nf b/modules/local/enchantr/report_file_size.nf
index 6ff1558c..b43e1c35 100644
--- a/modules/local/enchantr/report_file_size.nf
+++ b/modules/local/enchantr/report_file_size.nf
@@ -6,10 +6,12 @@ process REPORT_FILE_SIZE {
     label 'immcantation'
     label 'process_single'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     path logs
diff --git a/modules/local/enchantr/single_cell_qc.nf b/modules/local/enchantr/single_cell_qc.nf
index e8cf8830..5f1190e1 100644
--- a/modules/local/enchantr/single_cell_qc.nf
+++ b/modules/local/enchantr/single_cell_qc.nf
@@ -20,10 +20,12 @@ process SINGLE_CELL_QC {
     label 'immcantation'
     label 'process_medium'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     path(tabs)
diff --git a/modules/local/enchantr/validate_input.nf b/modules/local/enchantr/validate_input.nf
index e503ddf7..d87b27b2 100644
--- a/modules/local/enchantr/validate_input.nf
+++ b/modules/local/enchantr/validate_input.nf
@@ -6,10 +6,12 @@ process VALIDATE_INPUT {
     label 'immcantation'
     label 'process_single'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     file samplesheet
diff --git a/modules/local/reveal/add_meta_to_tab.nf b/modules/local/reveal/add_meta_to_tab.nf
index 71a2de00..b6c817a1 100644
--- a/modules/local/reveal/add_meta_to_tab.nf
+++ b/modules/local/reveal/add_meta_to_tab.nf
@@ -3,10 +3,12 @@ process ADD_META_TO_TAB {
     label 'immcantation'
     label 'process_single'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     cache 'deep' // Without 'deep' this process would run when using -resume
 
diff --git a/modules/local/reveal/filter_junction_mod3.nf b/modules/local/reveal/filter_junction_mod3.nf
index 246d3b25..fa312ece 100644
--- a/modules/local/reveal/filter_junction_mod3.nf
+++ b/modules/local/reveal/filter_junction_mod3.nf
@@ -3,10 +3,12 @@ process FILTER_JUNCTION_MOD3 {
     label 'immcantation'
     label 'process_single'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     tuple val(meta), path(tab) // sequence tsv in AIRR format
diff --git a/modules/local/reveal/filter_quality.nf b/modules/local/reveal/filter_quality.nf
index 4287c562..202840a4 100644
--- a/modules/local/reveal/filter_quality.nf
+++ b/modules/local/reveal/filter_quality.nf
@@ -3,10 +3,12 @@ process FILTER_QUALITY {
     label 'immcantation'
     label 'process_single'
 
-    conda "bioconda::r-enchantr=0.1.3"
+    if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) {
+        error "nf-core/airrflow currently does not support Conda. Please use a container profile instead."
+    }
     container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
-        'docker.io/ssnn/suite:prerelease':
-        'docker.io/ssnn/suite:prerelease' }"
+        'docker.io/immcantation/airrflow:devel':
+        'docker.io/immcantation/airrflow:devel' }"
 
     input:
     tuple val(meta), path(tab) // sequence tsv in AIRR format

From 41f5e123d3c5ccd3709af812aae7881ce4e6cc5b Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Mon, 25 Sep 2023 16:36:44 -0400
Subject: [PATCH 072/111] update changelog

---
 CHANGELOG.md | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/CHANGELOG.md b/CHANGELOG.md
index 785ff83a..5d02bbeb 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -13,6 +13,7 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0.
 - [#266](https://github.com/nf-core/airrflow/pull/266) Added clonal reports tables to final report folder.
 - [#266](https://github.com/nf-core/airrflow/pull/266) Added processes to include sampleID to filename in assembled workflow to keep it unique.
 - [#276](https://github.com/nf-core/airrflow/pull/276) Parametrize FindThreshold Report and Presto Buildconsensus UMI.
+- [#279](https://github.com/nf-core/airrflow/pull/279) Update to nf-core tools v2.10.
 
 ### `Fixed`
 
@@ -26,7 +27,7 @@ and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0.
 
 | Dependency | Old version | New version |
 | ---------- | ----------- | ----------- |
-| r-enchantr | 0.1.2       | 0.1.3       |
+| r-enchantr | 0.1.2       | 0.1.5       |
 
 ## [3.1.0] - 2023-06-05 "Protego"
 

From 5a2f42d93b1ba13d536e0aa7a8569fd5c778576b Mon Sep 17 00:00:00 2001
From: Gisela Gabernet 
Date: Mon, 25 Sep 2023 16:45:57 -0400
Subject: [PATCH 073/111] fix linting errors nf-core v2.10

---
 .github/CONTRIBUTING.md       |   4 +-
 .github/workflows/linting.yml |   2 +-
 CODE_OF_CONDUCT.md            | 133 ++++++++++++++++++++++++++--------
 lib/NfcoreTemplate.groovy     |  16 ++++
 4 files changed, 122 insertions(+), 33 deletions(-)

diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md
index 5cb3103c..902a3782 100644
--- a/.github/CONTRIBUTING.md
+++ b/.github/CONTRIBUTING.md
@@ -9,7 +9,9 @@ Please use the pre-filled template to save time.
 However, don't be put off by this template - other more general issues and suggestions are welcome!
 Contributions to the code are even more welcome ;)
 
-> If you need help using or modifying nf-core/airrflow then the best place to ask is on the nf-core Slack [#airrflow](https://nfcore.slack.com/channels/airrflow) channel ([join our Slack here](https://nf-co.re/join/slack)).
+:::info
+If you need help using or modifying nf-core/airrflow then the best place to ask is on the nf-core Slack [#airrflow](https://nfcore.slack.com/channels/airrflow) channel ([join our Slack here](https://nf-co.re/join/slack)).
+:::
 
 ## Contribution workflow
 
diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml
index 888cb4bc..b8bdd214 100644
--- a/.github/workflows/linting.yml
+++ b/.github/workflows/linting.yml
@@ -78,7 +78,7 @@ jobs:
 
       - uses: actions/setup-python@v4
         with:
-          python-version: "3.8"
+          python-version: "3.11"
           architecture: "x64"
 
       - name: Install dependencies
diff --git a/CODE_OF_CONDUCT.md b/CODE_OF_CONDUCT.md
index f4fd052f..c089ec78 100644
--- a/CODE_OF_CONDUCT.md
+++ b/CODE_OF_CONDUCT.md
@@ -1,18 +1,20 @@
-# Code of Conduct at nf-core (v1.0)
+# Code of Conduct at nf-core (v1.4)
 
 ## Our Pledge
 
-In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core, pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of:
+In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of:
 
 - Age
+- Ability
 - Body size
+- Caste
 - Familial status
 - Gender identity and expression
 - Geographical location
 - Level of experience
 - Nationality and national origins
 - Native language
-- Physical and neurological ability
+- Neurodiversity
 - Race or ethnicity
 - Religion
 - Sexual identity and orientation
@@ -22,80 +24,133 @@ Please note that the list above is alphabetised and is therefore not ranked in a
 
 ## Preamble
 
-> Note: This Code of Conduct (CoC) has been drafted by the nf-core Safety Officer and been edited after input from members of the nf-core team and others. "We", in this document, refers to the Safety Officer and members of the nf-core core team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will amended periodically to keep it up-to-date, and in case of any dispute, the most current version will apply.
+:::note
+This Code of Conduct (CoC) has been drafted by Renuka Kudva, Cris Tuñí, and Michael Heuer, with input from the nf-core Core Team and Susanna Marquez from the nf-core community. "We", in this document, refers to the Safety Officers and members of the nf-core Core Team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will be amended periodically to keep it up-to-date. In case of any dispute, the most current version will apply.
+:::
 
-An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). Our current safety officer is Renuka Kudva.
+An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about).
+
+Our Safety Officers are Saba Nafees, Cris Tuñí, and Michael Heuer.
 
 nf-core is a young and growing community that welcomes contributions from anyone with a shared vision for [Open Science Policies](https://www.fosteropenscience.eu/taxonomy/term/8). Open science policies encompass inclusive behaviours and we strive to build and maintain a safe and inclusive environment for all individuals.
 
-We have therefore adopted this code of conduct (CoC), which we require all members of our community and attendees in nf-core events to adhere to in all our workspaces at all times. Workspaces include but are not limited to Slack, meetings on Zoom, Jitsi, YouTube live etc.
+We have therefore adopted this CoC, which we require all members of our community and attendees of nf-core events to adhere to in all our workspaces at all times. Workspaces include, but are not limited to, Slack, meetings on Zoom, gather.town, YouTube live etc.
 
-Our CoC will be strictly enforced and the nf-core team reserve the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities.
+Our CoC will be strictly enforced and the nf-core team reserves the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities.
 
-We ask all members of our community to help maintain a supportive and productive workspace and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC.
+We ask all members of our community to help maintain supportive and productive workspaces and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC.
 
-Questions, concerns or ideas on what we can include? Contact safety [at] nf-co [dot] re
+Questions, concerns, or ideas on what we can include? Contact members of the Safety Team on Slack or email safety [at] nf-co [dot] re.
 
 ## Our Responsibilities
 
-The safety officer is responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour.
+Members of the Safety Team (the Safety Officers) are responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour.
 
-The safety officer in consultation with the nf-core core team have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this Code of Conduct, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful.
+The Safety Team, in consultation with the nf-core core team, have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this CoC, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful.
 
-Members of the core team or the safety officer who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and be subject to the same actions as others in violation of the CoC.
+Members of the core team or the Safety Team who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and will be subject to the same actions as others in violation of the CoC.
 
-## When are where does this Code of Conduct apply?
+## When and where does this Code of Conduct apply?
 
-Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events. This includes but is not limited to the following listed alphabetically and therefore in no order of preference:
+Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events, such as hackathons, workshops, bytesize, and collaborative workspaces on gather.town. These guidelines include, but are not limited to, the following (listed alphabetically and therefore in no order of preference):
 
 - Communicating with an official project email address.
 - Communicating with community members within the nf-core Slack channel.
 - Participating in hackathons organised by nf-core (both online and in-person events).
-- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence.
-- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, Jitsi, YouTube live etc.
+- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence, and on the nf-core gather.town workspace.
+- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, gather.town, Jitsi, YouTube live etc.
 - Representing nf-core on social media. This includes both official and personal accounts.
 
 ## nf-core cares 😊
 
-nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include but are not limited to the following (listed in alphabetical order):
+nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include, but are not limited to, the following (listed in alphabetical order):
 
 - Ask for consent before sharing another community member’s personal information (including photographs) on social media.
 - Be respectful of differing viewpoints and experiences. We are all here to learn from one another and a difference in opinion can present a good learning opportunity.
-- Celebrate your accomplishments at events! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !)
+- Celebrate your accomplishments! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !)
 - Demonstrate empathy towards other community members. (We don’t all have the same amount of time to dedicate to nf-core. If tasks are pending, don’t hesitate to gently remind members of your team. If you are leading a task, ask for help if you feel overwhelmed.)
 - Engage with and enquire after others. (This is especially important given the geographically remote nature of the nf-core community, so let’s do this the best we can)
 - Focus on what is best for the team and the community. (When in doubt, ask)
-- Graciously accept constructive criticism, yet be unafraid to question, deliberate, and learn.
+- Accept feedback, yet be unafraid to question, deliberate, and learn.
 - Introduce yourself to members of the community. (We’ve all been outsiders and we know that talking to strangers can be hard for some, but remember we’re interested in getting to know you and your visions for open science!)
-- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communications to be kind.**)
+- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communication to be kind.**)
 - Take breaks when you feel like you need them.
-- Using welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack.)
+- Use welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack)
 
 ## nf-core frowns on 😕
 
-The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this code of conduct. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces.
+The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this CoC. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces:
 
 - Deliberate intimidation, stalking or following and sustained disruption of communication among participants of the community. This includes hijacking shared screens through actions such as using the annotate tool in conferencing software such as Zoom.
 - “Doxing” i.e. posting (or threatening to post) another person’s personal identifying information online.
 - Spamming or trolling of individuals on social media.
-- Use of sexual or discriminatory imagery, comments, or jokes and unwelcome sexual attention.
-- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion or work experience.
+- Use of sexual or discriminatory imagery, comments, jokes, or unwelcome sexual attention.
+- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion, or work experience.
 
 ### Online Trolling
 
-The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the added issue of online trolling. This is unacceptable, reports of such behaviour will be taken very seriously, and perpetrators will be excluded from activities immediately.
+The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the risk of online trolling. This is unacceptable — reports of such behaviour will be taken very seriously and perpetrators will be excluded from activities immediately.
 
-All community members are required to ask members of the group they are working within for explicit consent prior to taking screenshots of individuals during video calls.
+All community members are **required** to ask members of the group they are working with for explicit consent prior to taking screenshots of individuals during video calls.
 
-## Procedures for Reporting CoC violations
+## Procedures for reporting CoC violations
 
 If someone makes you feel uncomfortable through their behaviours or actions, report it as soon as possible.
 
-You can reach out to members of the [nf-core core team](https://nf-co.re/about) and they will forward your concerns to the safety officer(s).
+You can reach out to members of the Safety Team (Saba Nafees, Cris Tuñí, and Michael Heuer) on Slack. Alternatively, contact a member of the nf-core core team [nf-core core team](https://nf-co.re/about), and they will forward your concerns to the Safety Team.
+
+Issues directly concerning members of the Core Team or the Safety Team will be dealt with by other members of the core team and the safety manager — possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson and details will be shared in due course.
+
+All reports will be handled with the utmost discretion and confidentiality.
+
+You can also report any CoC violations to safety [at] nf-co [dot] re. In your email report, please do your best to include:
+
+- Your contact information.
+- Identifying information (e.g. names, nicknames, pseudonyms) of the participant who has violated the Code of Conduct.
+- The behaviour that was in violation and the circumstances surrounding the incident.
+- The approximate time of the behaviour (if different than the time the report was made).
+- Other people involved in the incident, if applicable.
+- If you believe the incident is ongoing.
+- If there is a publicly available record (e.g. mailing list record, a screenshot).
+- Any additional information.
+
+After you file a report, one or more members of our Safety Team will contact you to follow up on your report.
+
+## Who will read and handle reports
+
+All reports will be read and handled by the members of the Safety Team at nf-core.
+
+If members of the Safety Team are deemed to have a conflict of interest with a report, they will be required to recuse themselves as per our Code of Conduct and will not have access to any follow-ups.
+
+To keep this first report confidential from any of the Safety Team members, please submit your first report by direct messaging on Slack/direct email to any of the nf-core members you are comfortable disclosing the information to, and be explicit about which member(s) you do not consent to sharing the information with.
+
+## Reviewing reports
+
+After receiving the report, members of the Safety Team will review the incident report to determine whether immediate action is required, for example, whether there is immediate threat to participants’ safety.
+
+The Safety Team, in consultation with members of the nf-core core team, will assess the information to determine whether the report constitutes a Code of Conduct violation, for them to decide on a course of action.
+
+In the case of insufficient information, one or more members of the Safety Team may contact the reporter, the reportee, or any other attendees to obtain more information.
 
-Issues directly concerning members of the core team will be dealt with by other members of the core team and the safety manager, and possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson, and details will be shared in due course.
+Once additional information is gathered, the Safety Team will collectively review and decide on the best course of action to take, if any. The Safety Team reserves the right to not act on a report.
 
-All reports will be handled with utmost discretion and confidentially.
+## Confidentiality
+
+All reports, and any additional information included, are only shared with the team of safety officers (and possibly members of the core team, in case the safety officer is in violation of the CoC). We will respect confidentiality requests for the purpose of protecting victims of abuse.
+
+We will not name harassment victims, beyond discussions between the safety officer and members of the nf-core team, without the explicit consent of the individuals involved.
+
+## Enforcement
+
+Actions taken by the nf-core’s Safety Team may include, but are not limited to:
+
+- Asking anyone to stop a behaviour.
+- Asking anyone to leave the event and online spaces either temporarily, for the remainder of the event, or permanently.
+- Removing access to the gather.town and Slack, either temporarily or permanently.
+- Communicating to all participants to reinforce our expectations for conduct and remind what is unacceptable behaviour; this may be public for practical reasons.
+- Communicating to all participants that an incident has taken place and how we will act or have acted — this may be for the purpose of letting event participants know we are aware of and dealing with the incident.
+- Banning anyone from participating in nf-core-managed spaces, future events, and activities, either temporarily or permanently.
+- No action.
 
 ## Attribution and Acknowledgements
 
@@ -106,6 +161,22 @@ All reports will be handled with utmost discretion and confidentially.
 
 ## Changelog
 
-### v1.0 - March 12th, 2021
+### v1.4 - February 8th, 2022
+
+- Included a new member of the Safety Team. Corrected a typographical error in the text.
+
+### v1.3 - December 10th, 2021
+
+- Added a statement that the CoC applies to nf-core gather.town workspaces. Corrected typographical errors in the text.
+
+### v1.2 - November 12th, 2021
+
+- Removed information specific to reporting CoC violations at the Hackathon in October 2021.
+
+### v1.1 - October 14th, 2021
+
+- Updated with names of new Safety Officers and specific information for the hackathon in October 2021.
+
+### v1.0 - March 15th, 2021
 
 - Complete rewrite from original [Contributor Covenant](http://contributor-covenant.org/) CoC.
diff --git a/lib/NfcoreTemplate.groovy b/lib/NfcoreTemplate.groovy
index 408951ae..01b8653d 100755
--- a/lib/NfcoreTemplate.groovy
+++ b/lib/NfcoreTemplate.groovy
@@ -3,6 +3,7 @@
 //
 
 import org.yaml.snakeyaml.Yaml
+import groovy.json.JsonOutput
 
 class NfcoreTemplate {
 
@@ -222,6 +223,21 @@ class NfcoreTemplate {
         }
     }
 
+    //
+    // Dump pipeline parameters in a json file
+    //
+    public static void dump_parameters(workflow, params) {
+        def output_d = new File("${params.outdir}/pipeline_info/")
+        if (!output_d.exists()) {
+            output_d.mkdirs()
+        }
+
+        def timestamp  = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')
+        def output_pf  = new File(output_d, "params_${timestamp}.json")
+        def jsonStr    = JsonOutput.toJson(params)
+        output_pf.text = JsonOutput.prettyPrint(jsonStr)
+    }
+
     //
     // Print pipeline summary on completion
     //

From 3bdc464b14f2372dab1690cf2fdee4f9b10423f1 Mon Sep 17 00:00:00 2001
From: nf-core-bot 
Date: Tue, 26 Sep 2023 08:08:39 +0000
Subject: [PATCH 074/111] Template update for nf-core/tools version 2.10

---
 .devcontainer/devcontainer.json               |   1 +
 .github/CONTRIBUTING.md                       |   4 +-
 .github/workflows/linting.yml                 |   2 +-
 .github/workflows/release-announcments.yml    |  68 +++++++++
 CHANGELOG.md                                  |   2 +-
 CITATIONS.md                                  |   2 +-
 CODE_OF_CONDUCT.md                            | 133 ++++++++++++++----
 README.md                                     |  21 +--
 assets/multiqc_config.yml                     |   4 +-
 conf/modules.config                           |   9 ++
 docs/output.md                                |   5 +-
 docs/usage.md                                 |  16 ++-
 lib/NfcoreTemplate.groovy                     |  16 +++
 lib/WorkflowAirrflow.groovy                   |   2 +-
 main.nf                                       |   3 +
 modules.json                                  |   6 +-
 .../custom/dumpsoftwareversions/main.nf       |   2 +-
 modules/nf-core/fastqc/main.nf                |   8 +-
 modules/nf-core/multiqc/main.nf               |   2 +-
 nextflow.config                               |   9 +-
 nextflow_schema.json                          |  15 --
 workflows/airrflow.nf                         |   1 +
 22 files changed, 253 insertions(+), 78 deletions(-)
 create mode 100644 .github/workflows/release-announcments.yml

diff --git a/.devcontainer/devcontainer.json b/.devcontainer/devcontainer.json
index ea27a584..4ecfbfe3 100644
--- a/.devcontainer/devcontainer.json
+++ b/.devcontainer/devcontainer.json
@@ -2,6 +2,7 @@
     "name": "nfcore",
     "image": "nfcore/gitpod:latest",
     "remoteUser": "gitpod",
+    "runArgs": ["--privileged"],
 
     // Configure tool-specific properties.
     "customizations": {
diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md
index 5cb3103c..902a3782 100644
--- a/.github/CONTRIBUTING.md
+++ b/.github/CONTRIBUTING.md
@@ -9,7 +9,9 @@ Please use the pre-filled template to save time.
 However, don't be put off by this template - other more general issues and suggestions are welcome!
 Contributions to the code are even more welcome ;)
 
-> If you need help using or modifying nf-core/airrflow then the best place to ask is on the nf-core Slack [#airrflow](https://nfcore.slack.com/channels/airrflow) channel ([join our Slack here](https://nf-co.re/join/slack)).
+:::info
+If you need help using or modifying nf-core/airrflow then the best place to ask is on the nf-core Slack [#airrflow](https://nfcore.slack.com/channels/airrflow) channel ([join our Slack here](https://nf-co.re/join/slack)).
+:::
 
 ## Contribution workflow
 
diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml
index 888cb4bc..b8bdd214 100644
--- a/.github/workflows/linting.yml
+++ b/.github/workflows/linting.yml
@@ -78,7 +78,7 @@ jobs:
 
       - uses: actions/setup-python@v4
         with:
-          python-version: "3.8"
+          python-version: "3.11"
           architecture: "x64"
 
       - name: Install dependencies
diff --git a/.github/workflows/release-announcments.yml b/.github/workflows/release-announcments.yml
new file mode 100644
index 00000000..6ad33927
--- /dev/null
+++ b/.github/workflows/release-announcments.yml
@@ -0,0 +1,68 @@
+name: release-announcements
+# Automatic release toot and tweet anouncements
+on:
+  release:
+    types: [published]
+  workflow_dispatch:
+
+jobs:
+  toot:
+    runs-on: ubuntu-latest
+    steps:
+      - uses: rzr/fediverse-action@master
+        with:
+          access-token: ${{ secrets.MASTODON_ACCESS_TOKEN }}
+          host: "mstdn.science" # custom host if not "mastodon.social" (default)
+          # GitHub event payload
+          # https://docs.github.com/en/developers/webhooks-and-events/webhooks/webhook-events-and-payloads#release
+          message: |
+            Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}!
+
+            Please see the changelog: ${{ github.event.release.html_url }}
+
+  send-tweet:
+    runs-on: ubuntu-latest
+
+    steps:
+      - uses: actions/setup-python@v4
+        with:
+          python-version: "3.10"
+      - name: Install dependencies
+        run: pip install tweepy==4.14.0
+      - name: Send tweet
+        shell: python
+        run: |
+          import os
+          import tweepy
+
+          client = tweepy.Client(
+              access_token=os.getenv("TWITTER_ACCESS_TOKEN"),
+              access_token_secret=os.getenv("TWITTER_ACCESS_TOKEN_SECRET"),
+              consumer_key=os.getenv("TWITTER_CONSUMER_KEY"),
+              consumer_secret=os.getenv("TWITTER_CONSUMER_SECRET"),
+          )
+          tweet = os.getenv("TWEET")
+          client.create_tweet(text=tweet)
+        env:
+          TWEET: |
+            Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}!
+
+            Please see the changelog: ${{ github.event.release.html_url }}
+          TWITTER_CONSUMER_KEY: ${{ secrets.TWITTER_CONSUMER_KEY }}
+          TWITTER_CONSUMER_SECRET: ${{ secrets.TWITTER_CONSUMER_SECRET }}
+          TWITTER_ACCESS_TOKEN: ${{ secrets.TWITTER_ACCESS_TOKEN }}
+          TWITTER_ACCESS_TOKEN_SECRET: ${{ secrets.TWITTER_ACCESS_TOKEN_SECRET }}
+
+  bsky-post:
+    runs-on: ubuntu-latest
+    steps:
+      - uses: zentered/bluesky-post-action@v0.0.2
+        with:
+          post: |
+            Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}!
+
+            Please see the changelog: ${{ github.event.release.html_url }}
+        env:
+          BSKY_IDENTIFIER: ${{ secrets.BSKY_IDENTIFIER }}
+          BSKY_PASSWORD: ${{ secrets.BSKY_PASSWORD }}
+          #
diff --git a/CHANGELOG.md b/CHANGELOG.md
index cd4fd023..ef5c8a27 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -3,7 +3,7 @@
 The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/)
 and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html).
 
-## v3.1.0 - [date]
+## v3.2.0dev - [date]
 
 Initial release of nf-core/airrflow, created with the [nf-core](https://nf-co.re/) template.
 
diff --git a/CITATIONS.md b/CITATIONS.md
index 7ba186a8..85c414d5 100644
--- a/CITATIONS.md
+++ b/CITATIONS.md
@@ -12,7 +12,7 @@
 
 - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/)
 
-  > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. Available online https://www.bioinformatics.babraham.ac.uk/projects/fastqc/.
+  > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online].
 
 - [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/)
 
diff --git a/CODE_OF_CONDUCT.md b/CODE_OF_CONDUCT.md
index f4fd052f..c089ec78 100644
--- a/CODE_OF_CONDUCT.md
+++ b/CODE_OF_CONDUCT.md
@@ -1,18 +1,20 @@
-# Code of Conduct at nf-core (v1.0)
+# Code of Conduct at nf-core (v1.4)
 
 ## Our Pledge
 
-In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core, pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of:
+In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of:
 
 - Age
+- Ability
 - Body size
+- Caste
 - Familial status
 - Gender identity and expression
 - Geographical location
 - Level of experience
 - Nationality and national origins
 - Native language
-- Physical and neurological ability
+- Neurodiversity
 - Race or ethnicity
 - Religion
 - Sexual identity and orientation
@@ -22,80 +24,133 @@ Please note that the list above is alphabetised and is therefore not ranked in a
 
 ## Preamble
 
-> Note: This Code of Conduct (CoC) has been drafted by the nf-core Safety Officer and been edited after input from members of the nf-core team and others. "We", in this document, refers to the Safety Officer and members of the nf-core core team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will amended periodically to keep it up-to-date, and in case of any dispute, the most current version will apply.
+:::note
+This Code of Conduct (CoC) has been drafted by Renuka Kudva, Cris Tuñí, and Michael Heuer, with input from the nf-core Core Team and Susanna Marquez from the nf-core community. "We", in this document, refers to the Safety Officers and members of the nf-core Core Team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will be amended periodically to keep it up-to-date. In case of any dispute, the most current version will apply.
+:::
 
-An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). Our current safety officer is Renuka Kudva.
+An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about).
+
+Our Safety Officers are Saba Nafees, Cris Tuñí, and Michael Heuer.
 
 nf-core is a young and growing community that welcomes contributions from anyone with a shared vision for [Open Science Policies](https://www.fosteropenscience.eu/taxonomy/term/8). Open science policies encompass inclusive behaviours and we strive to build and maintain a safe and inclusive environment for all individuals.
 
-We have therefore adopted this code of conduct (CoC), which we require all members of our community and attendees in nf-core events to adhere to in all our workspaces at all times. Workspaces include but are not limited to Slack, meetings on Zoom, Jitsi, YouTube live etc.
+We have therefore adopted this CoC, which we require all members of our community and attendees of nf-core events to adhere to in all our workspaces at all times. Workspaces include, but are not limited to, Slack, meetings on Zoom, gather.town, YouTube live etc.
 
-Our CoC will be strictly enforced and the nf-core team reserve the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities.
+Our CoC will be strictly enforced and the nf-core team reserves the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities.
 
-We ask all members of our community to help maintain a supportive and productive workspace and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC.
+We ask all members of our community to help maintain supportive and productive workspaces and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC.
 
-Questions, concerns or ideas on what we can include? Contact safety [at] nf-co [dot] re
+Questions, concerns, or ideas on what we can include? Contact members of the Safety Team on Slack or email safety [at] nf-co [dot] re.
 
 ## Our Responsibilities
 
-The safety officer is responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour.
+Members of the Safety Team (the Safety Officers) are responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour.
 
-The safety officer in consultation with the nf-core core team have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this Code of Conduct, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful.
+The Safety Team, in consultation with the nf-core core team, have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this CoC, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful.
 
-Members of the core team or the safety officer who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and be subject to the same actions as others in violation of the CoC.
+Members of the core team or the Safety Team who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and will be subject to the same actions as others in violation of the CoC.
 
-## When are where does this Code of Conduct apply?
+## When and where does this Code of Conduct apply?
 
-Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events. This includes but is not limited to the following listed alphabetically and therefore in no order of preference:
+Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events, such as hackathons, workshops, bytesize, and collaborative workspaces on gather.town. These guidelines include, but are not limited to, the following (listed alphabetically and therefore in no order of preference):
 
 - Communicating with an official project email address.
 - Communicating with community members within the nf-core Slack channel.
 - Participating in hackathons organised by nf-core (both online and in-person events).
-- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence.
-- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, Jitsi, YouTube live etc.
+- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence, and on the nf-core gather.town workspace.
+- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, gather.town, Jitsi, YouTube live etc.
 - Representing nf-core on social media. This includes both official and personal accounts.
 
 ## nf-core cares 😊
 
-nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include but are not limited to the following (listed in alphabetical order):
+nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include, but are not limited to, the following (listed in alphabetical order):
 
 - Ask for consent before sharing another community member’s personal information (including photographs) on social media.
 - Be respectful of differing viewpoints and experiences. We are all here to learn from one another and a difference in opinion can present a good learning opportunity.
-- Celebrate your accomplishments at events! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !)
+- Celebrate your accomplishments! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !)
 - Demonstrate empathy towards other community members. (We don’t all have the same amount of time to dedicate to nf-core. If tasks are pending, don’t hesitate to gently remind members of your team. If you are leading a task, ask for help if you feel overwhelmed.)
 - Engage with and enquire after others. (This is especially important given the geographically remote nature of the nf-core community, so let’s do this the best we can)
 - Focus on what is best for the team and the community. (When in doubt, ask)
-- Graciously accept constructive criticism, yet be unafraid to question, deliberate, and learn.
+- Accept feedback, yet be unafraid to question, deliberate, and learn.
 - Introduce yourself to members of the community. (We’ve all been outsiders and we know that talking to strangers can be hard for some, but remember we’re interested in getting to know you and your visions for open science!)
-- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communications to be kind.**)
+- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communication to be kind.**)
 - Take breaks when you feel like you need them.
-- Using welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack.)
+- Use welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack)
 
 ## nf-core frowns on 😕
 
-The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this code of conduct. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces.
+The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this CoC. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces:
 
 - Deliberate intimidation, stalking or following and sustained disruption of communication among participants of the community. This includes hijacking shared screens through actions such as using the annotate tool in conferencing software such as Zoom.
 - “Doxing” i.e. posting (or threatening to post) another person’s personal identifying information online.
 - Spamming or trolling of individuals on social media.
-- Use of sexual or discriminatory imagery, comments, or jokes and unwelcome sexual attention.
-- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion or work experience.
+- Use of sexual or discriminatory imagery, comments, jokes, or unwelcome sexual attention.
+- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion, or work experience.
 
 ### Online Trolling
 
-The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the added issue of online trolling. This is unacceptable, reports of such behaviour will be taken very seriously, and perpetrators will be excluded from activities immediately.
+The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the risk of online trolling. This is unacceptable — reports of such behaviour will be taken very seriously and perpetrators will be excluded from activities immediately.
 
-All community members are required to ask members of the group they are working within for explicit consent prior to taking screenshots of individuals during video calls.
+All community members are **required** to ask members of the group they are working with for explicit consent prior to taking screenshots of individuals during video calls.
 
-## Procedures for Reporting CoC violations
+## Procedures for reporting CoC violations
 
 If someone makes you feel uncomfortable through their behaviours or actions, report it as soon as possible.
 
-You can reach out to members of the [nf-core core team](https://nf-co.re/about) and they will forward your concerns to the safety officer(s).
+You can reach out to members of the Safety Team (Saba Nafees, Cris Tuñí, and Michael Heuer) on Slack. Alternatively, contact a member of the nf-core core team [nf-core core team](https://nf-co.re/about), and they will forward your concerns to the Safety Team.
+
+Issues directly concerning members of the Core Team or the Safety Team will be dealt with by other members of the core team and the safety manager — possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson and details will be shared in due course.
+
+All reports will be handled with the utmost discretion and confidentiality.
+
+You can also report any CoC violations to safety [at] nf-co [dot] re. In your email report, please do your best to include:
+
+- Your contact information.
+- Identifying information (e.g. names, nicknames, pseudonyms) of the participant who has violated the Code of Conduct.
+- The behaviour that was in violation and the circumstances surrounding the incident.
+- The approximate time of the behaviour (if different than the time the report was made).
+- Other people involved in the incident, if applicable.
+- If you believe the incident is ongoing.
+- If there is a publicly available record (e.g. mailing list record, a screenshot).
+- Any additional information.
+
+After you file a report, one or more members of our Safety Team will contact you to follow up on your report.
+
+## Who will read and handle reports
+
+All reports will be read and handled by the members of the Safety Team at nf-core.
+
+If members of the Safety Team are deemed to have a conflict of interest with a report, they will be required to recuse themselves as per our Code of Conduct and will not have access to any follow-ups.
+
+To keep this first report confidential from any of the Safety Team members, please submit your first report by direct messaging on Slack/direct email to any of the nf-core members you are comfortable disclosing the information to, and be explicit about which member(s) you do not consent to sharing the information with.
+
+## Reviewing reports
+
+After receiving the report, members of the Safety Team will review the incident report to determine whether immediate action is required, for example, whether there is immediate threat to participants’ safety.
+
+The Safety Team, in consultation with members of the nf-core core team, will assess the information to determine whether the report constitutes a Code of Conduct violation, for them to decide on a course of action.
+
+In the case of insufficient information, one or more members of the Safety Team may contact the reporter, the reportee, or any other attendees to obtain more information.
 
-Issues directly concerning members of the core team will be dealt with by other members of the core team and the safety manager, and possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson, and details will be shared in due course.
+Once additional information is gathered, the Safety Team will collectively review and decide on the best course of action to take, if any. The Safety Team reserves the right to not act on a report.
 
-All reports will be handled with utmost discretion and confidentially.
+## Confidentiality
+
+All reports, and any additional information included, are only shared with the team of safety officers (and possibly members of the core team, in case the safety officer is in violation of the CoC). We will respect confidentiality requests for the purpose of protecting victims of abuse.
+
+We will not name harassment victims, beyond discussions between the safety officer and members of the nf-core team, without the explicit consent of the individuals involved.
+
+## Enforcement
+
+Actions taken by the nf-core’s Safety Team may include, but are not limited to:
+
+- Asking anyone to stop a behaviour.
+- Asking anyone to leave the event and online spaces either temporarily, for the remainder of the event, or permanently.
+- Removing access to the gather.town and Slack, either temporarily or permanently.
+- Communicating to all participants to reinforce our expectations for conduct and remind what is unacceptable behaviour; this may be public for practical reasons.
+- Communicating to all participants that an incident has taken place and how we will act or have acted — this may be for the purpose of letting event participants know we are aware of and dealing with the incident.
+- Banning anyone from participating in nf-core-managed spaces, future events, and activities, either temporarily or permanently.
+- No action.
 
 ## Attribution and Acknowledgements
 
@@ -106,6 +161,22 @@ All reports will be handled with utmost discretion and confidentially.
 
 ## Changelog
 
-### v1.0 - March 12th, 2021
+### v1.4 - February 8th, 2022
+
+- Included a new member of the Safety Team. Corrected a typographical error in the text.
+
+### v1.3 - December 10th, 2021
+
+- Added a statement that the CoC applies to nf-core gather.town workspaces. Corrected typographical errors in the text.
+
+### v1.2 - November 12th, 2021
+
+- Removed information specific to reporting CoC violations at the Hackathon in October 2021.
+
+### v1.1 - October 14th, 2021
+
+- Updated with names of new Safety Officers and specific information for the hackathon in October 2021.
+
+### v1.0 - March 15th, 2021
 
 - Complete rewrite from original [Contributor Covenant](http://contributor-covenant.org/) CoC.
diff --git a/README.md b/README.md
index 6a23f938..accfbf6d 100644
--- a/README.md
+++ b/README.md
@@ -1,6 +1,7 @@
 # ![nf-core/airrflow](docs/images/nf-core-airrflow_logo_light.png#gh-light-mode-only) ![nf-core/airrflow](docs/images/nf-core-airrflow_logo_dark.png#gh-dark-mode-only)
 
-[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/airrflow/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX)
+[![GitHub Actions CI Status](https://github.com/nf-core/airrflow/workflows/nf-core%20CI/badge.svg)](https://github.com/nf-core/airrflow/actions?query=workflow%3A%22nf-core+CI%22)
+[![GitHub Actions Linting Status](https://github.com/nf-core/airrflow/workflows/nf-core%20linting/badge.svg)](https://github.com/nf-core/airrflow/actions?query=workflow%3A%22nf-core+linting%22)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/airrflow/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.XXXXXXX-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.XXXXXXX)
 
 [![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/)
 [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/)
@@ -29,10 +30,11 @@
 
 ## Usage
 
-> **Note**
-> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how
-> to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline)
-> with `-profile test` before running the workflow on actual data.
+:::note
+If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how
+to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline)
+with `-profile test` before running the workflow on actual data.
+:::