Warnings from snpEff

[iminkin]

Hi Son and iLya,

1/ When run C-sibelia.py : I see it used Sibelia binary file to processing

C-Sibelia.py NCTC8325.fasta RN4220.fasta
Calculating synteny blocks...
Simplification stage 1 of 3
Enumerating vertices of the graph, then performing bulge removal...[..................................................]
Simplification stage 2 of 3
Enumerating vertices of the graph, then performing bulge removal...[..................................................]
Simplification stage 3 of 3
Enumerating vertices of the graph, then performing bulge removal...[..................................................]
Finding synteny blocks and generating the output...[..................................................]
Calling variants...

2/ When I have a variant.vcf file, I run this command "/mzserver/execute/Sibelia/bin/snpEffAnnotate.py -i /home/linuxpham/source/Sibelia/examples/C-Sibelia/Staphylococcus_aureus/variant.vcf"
And I see the warning as the below:

Namespace(config='/mzserver/execute/Sibelia/bin/snpEff/snpEff.config', db='Staphylococcus_aureus_NCTC_8325_uid57795', dest='annotation', source='/home/linuxpham/source/Sibelia/examples/C-Sibelia/Staphylococcus_aureus/variant.vcf')
Error while processing VCF entry (line 119) :
NC_007795 2578254 . GCGTTGGTGGCACGATTGGAGGTGTTGTATCTTCTTCAATCGTTTGTTGACCTTCATTATGACCACTTACTTGTGGAAG GTGTTGGTGTTTCCGGCTCGCTTGGTACTTCTGGTGTCGGTGGCGTTGGTGGCACGATTGGAGGTGT . . .
java.lang.RuntimeException: Deletion '+C-GTTTTTTAATACT' does not start with '-'. This should never happen!

Why do these warnings occur?